Best of Cell Reports 2023; Current Biology: Ancient DNA challenges prevailing interpretations of the Pompeii plaster casts [Starożytne DNA podważa obowiązujące interpretacje odlewów gipsowych z Pompejów]

Opublikowano przez

Ancient DNA challenges prevailing interpretations of the Pompeii plaster casts

Porównajcie filmik z Discovery Future i jego narrację z faktycznym materiałem naukowym.

 

Discovery Future: Scientists FINALLY Sequenced The DNA of Pompeii’s Victims and It Changes Everything!

https://www.youtube.com/watch?v=bx4xucUkyco

https://www.youtube.com/watch?v=bx4xucUkyco

Highlights
•
We generated genome-wide data from skeletal material in Pompeii plaster casts
•
The data contradict prior narratives about the victims’ identities and relationships
Najważniejsze informacje
• Wygenerowaliśmy dane dotyczące całego genomu z materiału szkieletowego w gipsowych odlewach z Pompejów
• Dane przeczą wcześniejszym narracjom na temat tożsamości i relacji ofiar
Pompeiian individuals mainly descended from recent eastern Mediterranean immigrants
Pompeii was a Roman town located in Campania, Italy, 14 miles southeast of Naples. It was destroyed by the 79 CE Plinian eruption of Somma-Vesuvius, also known as the “Pompeii eruption.” The city was buried under a pumice lapilli deposit, laid down during the early phase of the eruption, followed by ash deposits from pyroclastic currents during a later phase. The town remained largely forgotten until its rediscovery in the late 1700s. Its unique preservation and the insight it provides into daily life in the Roman Empire have led to Pompeii becoming one of the world’s best-known archaeological sites and being designated as a UNESCO World Heritage Site.
The earliest stable settlements in the Gulf of Naples in the Iron Age (IA) date to the 8th century BCE, when the Osci built houses near the estuary of the river Sarno on a small hill, representing the remnants of multiple local volcanic vents rising on the surrounding Sarno plain. Due to its strategic location, Pompeii became an important road and port node. The Greeks, Etruscans, and Samnites all attempted to conquer Pompeii, and it eventually became a Roman colony.
The 79 CE eruption completely destroyed Pompeii, but the pyroclastic deposits that blanketed the city preserved its buildings, streets, and artifacts. Many bodies were also preserved, as were the art, jewelry, book rolls, and other cultural remnants of the inhabitants. During the excavations that began in 1748, numerous victims, both isolated and grouped, were found in the houses and in squares, gardens, and streets just outside the city walls.,,, In the 19th century, archaeologist Giuseppe Fiorelli developed a method of making casts by pouring liquid plaster into the voids left by decay of the victims’ soft tissue. Since then, over 1,000 human victims have been discovered among the city’s ruins, and 104 plaster casts preserving the victims’ shapes and encasing their bones have been produced using Fiorelli’s method. In 2015, during restoration of 86 casts, an effort to computed tomography (CT) scan or X-ray 26 of them revealed that none contained complete skeletons. The casts had been considerably manipulated and likely creatively restored in the past, with stylistic variations between casts in part reflecting aesthetic preferences of the periods in which they were made. Popular interpretations of the identity of the victims in Pompeii, therefore, are influenced not only by the archaeologists first describing them but also by the restorers who chose to enhance or alter some features of the bodies’ shapes. The imaging results revealed in some cases the introduction of stabilizing elements like metal rods, as well as the frequent removal of bones prior to the casting process, complicating the sex determination on an osteological basis. It was possible to reinterpret some casts, such as the formerly imagined distended abdomen of a putative pregnant woman likely being formed by bunched up garments.
Multiple studies have confirmed the possibility of retrieving DNA data from both human and animal remains in Pompeii.,,,,,,,,,, Recently, genetic data from human skeletal remains found in the Casa del Fabbro showed that this individual’s genetic ancestry fell within the genetic diversity observed in the Imperial Roman Latium (modern Lazio) region, which had more Eastern Mediterranean influence compared with the preceding IA. As a port, Pompeii is typically viewed as a city with a diverse and mobile population. Bioarcheological analysis, however, revealed high frequencies of non-metric traits that may indicate genetic homogeneity or common environmental influences. Ancient DNA and strontium isotopes offer the possibility of obtaining a better understanding of the diversity and origins of Pompeii’s residents.
We attempted to extract genetic information from the human plaster casts, using enrichment of ancient DNA extracts for mitochondrial DNA and more than a million single nucleotide polymorphism (SNP) targets. The study was carried out on highly fragmented skeletal remains mixed with plaster recovered from different anatomical elements of 14 of the 86 casts undergoing restoration. Figure S1 presents a map showing where the 14 victims were found and the casts made. Our goal was to test interpretations suggested in the absence of genetic data about the identity of the victims and their relations to each other, based on the shape and position of the bodies, and to enhance the information on osteological data previously obtained by X-ray and CT imaging of the mostly incomplete skeletons in the casts. Such inferences have shaped how historians, archaeologists, and the public imagine the society recorded so vividly by the catastrophe. In addition, we investigated the victims’ genetic ancestry and compared it with the known genetic diversity from contemporaneous individuals from the city of Rome and its hinterland.
Results and discussion
DNA preservation and uniparentally inherited markers
In the following section, we describe the individuals using the cast numbers that are commonly used in the bioarcheological literature about the site. The corresponding genetic IDs can be found in Table 1 and Data S1A. We took samples of bone fragments mixed with plaster from 14 different casts (Table S1; Figure S1) and screened them by quantifying the concentration and degradation of the DNA (Table S2), as well as using a hybridization-based approach to enrich for the mitochondrial DNA and 3,000 autosomal SNPs (Tables S3 and S4). On the basis of the screening results, we chose to enrich seven partially UDG-treated libraries for around 1.2 million nuclear SNPs (“1,240,000” SNP set) (Data S1A). Additionally, we radiocarbon-dated four of the selected individuals (Data S1B).
Cast number Genetic ID Discovery place SNPs of 1,240,000 set covered Average coverage on 1,240,000 SNP set Genetic sex Quantifiler Trio Y target Y haplogroup mtDNA haplogroup C-to-T at 5′ end (non-UDG library) C-to-T at 5′ end (UDG library) ANGSD X chromosome contamination estimate: Number of SNPs ANGSD X chromosome contamination estimate: Mean ANGSD X chromosome contamination estimate: C.I.
22 I3690 House of the Cryptoporticus 93,727 0.09 M M J2b2a1 N1b1a1 0.3 0.09 19 N/A N/A
25 I3682 Villa of Mysteries 53,739 0.047 M N/Aa E1b1b1b1b H N/A 0.1 0 N/A N/A
50 I3683 House of the Golden Bracelet N/A N/A N/A M N/A H1h1 0.23 N/A N/A N/A N/A
51 I3686 House of the Golden Bracelet 62,030 0.054 M M J2a1a4b T2c1c 0.15 0.04 4 N/A N/A
52 I3685 House of the Golden Bracelet 364,533 0.437 M M T1a1a1b2b2b1a U1a1 0.2 0.02 350 0.0187 0–0.039
53 I3691 House of the Golden Bracelet 286,023 0.309 M M E1b1b H 0.24 0.04 208 0.0086 0–0.026

Table 1

Summary of genetic results
See also Figure S1.
a
Quantification not performed
Five samples provided complete or partial mitochondrial genomes, with patterns of base misincorporations at the read-ends typical of ancient DNA (Table S3), and were covered on at least 50,000 of the targeted autosomal SNPs, with median coverage on the 1,240,000 SNPs ranging from 0.006× to 0.437× (Table 1; Data S1A). All five individuals (Figure 1) were genetically sexed as male, as assessed by DNA quantification using the Quantifiler Trio Kit (STAR Methods). We also estimated contamination on the X chromosome for the two individuals for which there was sufficient data to make this quantification and found it was below 4%. In the other cases, the molecular damage pattern and contamination estimates provided by mitochondrial data (Tables 1 and S3; Data S1A) indicate that the results are compatible with authentic ancient DNA originating from a single individual. All individuals were determined to belong to Y-chromosome lineages (J2a, J2b, E1b, and T1a) that first emerged in Western Asia and are today still found in the highest frequencies in Western and Central Asia, Southern Europe, and North Africa,,,, (Data S1C). None of the individuals had evidence of relatedness up to the third degree (Data S1D).
Figure 1 Pompeii plaster casts and their original locations in Pompeii
The plaster cast individuals represent an ancestrally diverse population
We find that the five individuals are shifted away from modern-day Italians as well as Italian populations from the IA and Late IA and Imperial-period Etruscans on a principal component analysis (PCA) constructed on modern-day West Eurasian and North African populations and world-wide populations. Instead, they cluster more with eastern Mediterranean, Levantine, and North African Jewish populations (Figures 2A and 2B). This pattern is similar to the one found for the Imperial Roman population of Central Italy and the previously published single individual from Pompei with genome-wide data, which we co-plotted with the five individuals with newly generated data. In an unsupervised ADMIXTURE analysis at k = 6 (Figures 2C, S2, and S3), the Pompeiian individuals differ from the roughly contemporaneous individuals associated with the Etruscan culture in their proportions of the ancestry components maximized in Mesolithic European hunter-gatherers (lower in the Pompeiians) as well as hunter-gatherers from the Caucasus (higher in the Pompeiians), making their ancestry composition more similar to the Central Italian Imperial Romans as well as contemporaneous individuals from the Aegean and Anatolia. Individual 52 shows an ancestry composition comparable to IA and Roman-period Levantine individuals, characterized by a minor component maximized in modern-day Sub-Saharan African populations and an absence of the component maximized in European hunter-gatherers. This individual most closely clusters with Levantine populations.
Figure 2 Principal component analysis and admixture analysis
To quantify the contribution of different ancestry sources, we tested various 2- and 3-way models using qpAdm and report the working models using the least number of sources, with p > 0.01 and coefficients below 1 (Data S2A and S2B). Using a distal set of putative ancestral populations, we found working models for all individuals (Figure 3). For each individual from the casts, ancestry related to Anatolia Neolithic farmers (TUR_Marmara_Barcin_N) and/or Levantine Pre-Pottery Neolithic farmers (Levant_PPN) composes the largest inferred proportion (48%–75%), whereas the second-largest proportion is inferred to derive from people related to Neolithic farmers from Iran (IRN_Ganj-Dareh_N) (26%–45%), with exception of individual 25, who can be modeled as deriving 65.3% ± 4.5% of his ancestry from Levant_PPN farmers and 34.7% ± 4.5% from Bronze Age steppe pastoralists (Steppe_EMBA), an ancestry source required by none of the other individuals. This model indicates, despite the low coverage of the individual’s genome, a different ancestry history involving European sources that did not contribute to the other individuals.
Figure 3 Distal qpAdm models
Individuals 22 and 51 can be described as composed of around 62%–69% Anatolia Neolithic farmer (TUR_Marmara_Barcin_N) and 31%–38% Neolithic farmer from Iran (IRN_Ganj-Dareh_N) ancestry. Individual 52 is inferred to have no Anatolia Neolithic farmer (TUR_Marmara_Barcin_N) ancestry. Instead, he can be modeled as deriving 57.7% ± 3.1% and 42.3% ± 3.1% of his ancestry from Levant_PPN farmers and Neolithic farmers from Iran (IRN_Ganj-Dareh_N), respectively. This result corroborates the closer clustering of this individual with contemporaneous Levantine individuals in PCA and ADMIXTURE analysis (Figure 3) and suggests a recent Levantine origin for him or his direct ancestors. Two alternative 3-way models are not rejected for individual 53. In both, the largest proportion of ancestry is accounted for by the combination of components derived from Neolithic farmers from Iran (IRN_Ganj-Dareh_N) and Anatolia Neolithic farmers (TUR_Marmara_Barcin_N)—69%–88% and 84%–97%, respectively. The third component is derived either from Neolithic farmers from the Levant (Levant_PPN) with 21.2% ± 7.1% or Chalcolithic individuals with North African ancestry (Mediterranean_CA_NorthAfrican) with 9.8% ± 2.8%.
We also tested the individuals as potentially derived from more proximal sources, consisting of late 2nd BCE to early 1st millennium CE individuals from different West Eurasian and North African regions that, within their grouping, are relatively genetically homogeneous according to the PCA (Data S2C and S2D). The working models (p > 0.01) largely require Eastern Mediterranean, Levantine, or North African populations as the main source (Data S2C). Models with ancestry indistinguishable from one of the sources, Turkey_West and Turkey_Central, work for individual 22 and individual 51. Working 2-way models for individual 25 involve an eastern Mediterranean source, which contributed the majority of ancestry, in combination with a Balkan, Central Mediterranean, or Central European source. Similarly, individual 53 can only be fit as a mixture of ancestry sources, with three tested models, ∼80% Turkey_Central with 20% Sardinia_Punic, ∼67% Turkey_East with ∼33% Sardinia_Punic, and ∼80% Lebanon with ∼20% Italy_IA (IA individuals from the Italian peninsula), all fitting the data. No working 1- or 2-way model was found for individual 52, but the feasible models with the highest p values (between 1.64e−3 and 2.321e−6) all contain Egypt as the source contributing the majority of the ancestry (∼51%–73%), suggesting the actual source is genetically similar to the one represented by the Hellenistic Egyptian individuals (Data S2D). The previously published individual f1R requires for all working models about 73%–84% from the Lebanon source, in combination with a European source.
Demographic and phenotypic characteristics
Only individual 52 provided enough genetic data to detect runs of homozygosity (ROHs), which can give insight into effective population size and marriage practices. Only a single short ROH of 4.71 cM was found in this individual (Figure S4), inconsistent with closely related parents or a small population of origin in which individuals share marked background relatedness. Overall, the genetic heterogeneity seen in the sample of genomes from Pompeii and the absence of long ROHs in one individual are consistent with a large, diverse population, as is suggested by its role as a river port and its description as being composed of various local and immigrant cultural groups by ancient authors. This provides some support for the hypothesis that the high frequencies of some non-metric traits observed among the 79 CE eruption victims could be due to shared environmental variables during developmental stages rather than a common genetic background. However, among the individuals we studied genetically, only individual 22 exhibited such common non-metric traits, specifically the presence of relatively large ossicles at lambda and Wormian bones in the lambdoid suture. Targeted genetic analyses of individuals with and without such traits might reveal a level of homogeneity in ancestry among the former.
Phenotypic markers for externally visible characteristics, assessed with the HIrisPlex-S system, suggest highest probabilities for brown eyes for individuals 25, 51, and 53 and dark skin and black hair for individual 52 (Data S3A). Several risk alleles associated with different diseases were detected in all the samples analyzed, but the low coverage and possible interaction between genotype and environment did not allow us to predict any of these traits with certainty (Data S3B–S3G).
Combined genetic and osteological findings contradict some of the established popular narratives
Scholars, as well as the public’s imagination, have interpreted the impressions of body position and shape in the plaster casts in diverse ways, speculating about the identities of the victims and their potential connections to each other. When the restoration and the study of the casts through new scientific approaches began in 2015, there were no peer-reviewed osteological references providing sound data for an individual characterization, and the only information available was that provided by the archaeologists. Nevertheless, some interpretations about sex and relationships between individuals found wide appeal with the scholars’ community and the public, being spread through museal exhibitions and educational and publicity materials. Therefore, integrating our newly reported genetic and isotopic data allows us to revisit some of the widespread interpretations.
House of the golden bracelet
The house of the golden bracelet is situated in Insula 17, Regio VI (Figure 1). The house’s innovative and complex architectural form resulted from a fusion between the Roman-Italic model of the atrium house and that of the suburban villa. Built on three levels, it utilized the city walls and the slope of the hillside. Its rooms were arranged in terraces on the three levels in a panoramic position. The house was especially rich, and colorful frescoes decorated its walls. In 1974, four victims were discovered in close vicinity to one another at the site and were interpreted as constituting a genetically related family. The first three victims were found at the foot of the staircase that led to the garden and seafront: two adults (individuals 50 and 52) and a young child (individual 51), apparently standing on individual 52’s hip. Individual 52 was traditionally interpreted as a woman and mother due to the association with the child and an intricate golden bracelet of exceptional weight (6.1 g) worn on one arm, which also gave the house its name. The other adult, individual 50, was interpreted as the father in the genetically related family group. On the basis of limited X-ray analysis, individuals 50, 51, and 52 were estimated to be a young adult, a 5- to 6-year-old, and a younger middle-aged adult, respectively, but a clear sex attribution could not be made for either of the adults or the child. It has been suggested that these three victims sought refuge in the stairwell and were killed by the staircase that collapsed as they tried to flee their residence for the city’s port. A few meters away, a body of a child of about 4 years old was found (individual 53), interpreted as a boy due to a bulge in the plaster in the area of the genitalia. This child was plausibly separated from the family group during the escape along the corridor leading to the garden.
DNA quantification allowed us to estimate the molecular sex of all the individuals, although sex identification on the basis of nuclear genome analysis was only possible for three of the individuals (all but individual 50). All individuals were sexed as genetically male, including the presumed female adult (individual 52). Furthermore, both the mitochondrial DNA and whole-genome data found no evidence of biological relatedness, at least up to the third degree, between any of the individuals, falsifying the prevailing narrative of these four victims as a genetically related family. The preservation of genetic material in the adult individual 50 allowed us to reconstruct only the mitochondrial genome, showing no matrilineal relations with the other three individuals, although we cannot exclude that he could be related to them at the nuclear level. The PCA and ADMIXTURE analyses show a considerable variation in the distribution of these three individuals within the genetic diversity observed for the Italian inhabitants of Imperial Rome (Figure 2). The composition of genetic ancestry of the three individuals inferred by qpAdm appears distinct in both distal and proximal modeling (Data S2), which suggests that their respective ancestors had origins in different Eastern Mediterranean or North African populations. Trying to reconstruct the appearance of these individuals by inferring phenotypes based on genotypes, we found that individual 52 had black hair and dark skin, whereas we were able to attest to only the eye color for individuals 51 and 53, which was brown (Data S3A).
House of the cryptoporticus
The house of the cryptoporticus is situated in Insula 6, Regio I (Figure 1). The house was originally built in the 3rd century BCE. It takes its current name from the cryptoporticus, an underground passageway with openings, running along three sides of the quadrangular south-opening garden. A living room (the oecus) and four thermal bathing rooms (apodyterium, frigidarium, tepidarium, and calidarium, the latter being preceded by a praefurnium) open onto it. The cryptoporticus originally had barrel and cross vaulted ceilings, and the walls of the oecus were decorated with a series of scenes inspired by the Iliad, providing one of the finest examples of Pompeiian painting from the final stage of the second style (era of Augustus). The walls of the four bathing rooms were also painted with exquisite scenic images. During the excavations in 1914, nine individuals were found in the garden in front of the house, but it was only possible to produce casts for four of them. Among these four individuals, two (individuals 21 and 22) were found close to each other in what was interpreted as an embrace (Figure 1), and the archaeologists hypothesized that they could be two sisters, mother and daughter, or lovers.,,,, CT scanning of skeletal elements preserved within the casts led to an age estimate of 14–19 for individual 21 and a young adult age for individual 22. Osteological sex estimation was not possible, but the relative gracility of individual 22’s skull was noted. The nuclear genetic analysis was successful only for individual 22 and revealed that he was male, excluding the possibility that the pair of victims were sisters or mother and daughter. Like all the other analyzed samples, the individual falls within Mediterranean nuclear genetic variability, with an ancestral origin consistent with contemporaneous Anatolian populations (Data S2C), and carries the mitochondrial haplogroup N1b1a1, with a presumably Near Eastern/North African origin., Reconstruction of the mitochondrial genome was also successful for individual 21 (Data S1), which carries the two derived SNPs of the distinct haplogroup R and none of the derived SNPs leading to N1b1a1, which is consistent with a lack of maternal relatedness between the two individuals.
Villa of the mysteries
This villa, which was first excavated in 1909–1910 and is still subject to minor investigations arising from protection and conservation concerns today, is located northwest of the town walls, near the ancient seashore (Figure 1). Most of its walls, ceilings, and particularly, its frescoes survived the eruption of Vesuvius largely intact. The name (Villa dei Misteri) comes from a series of frescoes dating back to the 1st century BCE, depicting a ritual probably dedicated to Bacchus, the god of wine, fertility, and religious ecstasy. The villa was very large, with many different rooms and functional spaces, as was common for many Roman villas of that period. A wine press was found and restored in its original location, reflecting the fact that it was common for wealthy families to produce their own wine, olive oil, and other products because most villas included some farmland. The bodies of two adults, interpreted as women, and a child were found in the pumice lapilli deposit, indicating that they were caught in the early stages of the eruption on the upper floor of the farm section and fell to the lower floor. Six bodies were found in the overlaying ash deposits, indicating that they had survived the first phase of the eruption. Among them, individual 25 was found alone in a room, lying atop a layer of ash, with an iron ring with an engraved carnelian of a female figurine on the little finger of the left hand, five bronze coins, and a whip as personal effects (Figure S1). The cast of this victim shows some of the most well-preserved anatomical and textile details. The man was about 1.85 m tall, thin, with a convex nasal bridge. According to the traces of his clothes and the ornaments, he was supposed to belong to a low social status and was interpreted as the custodian of the villa who had faithfully remained at his post. Our genetic analysis confirms a male sex estimation and mixed genetic ancestry that could possibly be traced to both Eastern Mediterranean and European sources (Data S2C). To learn more about this individual’s geographic origin and lifetime mobility, we conducted strontium and oxygen isotope analysis (Figure 4). Although the strontium measurement (87Sr/86Sr = 0.7084729 ± 0.00001) is higher than values found at Pompeii (μ = 0.70806, n = 2), this value is consistent with the bioavailable Sr range found across the southern Campania plain (Figure 4A [0.7075–0.7085]). This is outside of the local range described in the Roman population of Latio, and regions across Northern and Southern Italy.,, The δ18Oenamel composition (δ18O VSMOW = 26.77‰, δ18O VPDB = −4.03‰) is consistent with coastal distributions of δ18O values in the central Italian peninsula (Figure 4B).,, Isotopic affinities with bioavailable 87Sr/86Sr and δ18O across the central Italian peninsula potentially indicate early residency in and around Pompeii; however, although this assessment suggests local origins that fall within the expected local ranges, similarities in geologic and bioavailable isotope systems are found across the Mediterranean.,
Figure 4 Strontium and oxygen analysis of individual 25 from villa of the mysteries
Besides emphasizing the cosmopolitanism and mobility that shaped urban Roman Imperial populations, this study illustrates how unreliable narratives based on limited evidence can be, often reflecting the worldview of the researchers at the time. In this light, genetic analysis can greatly enrich these narratives when integrated with archaeological data. For example, at two of the villas we analyzed, individuals previously assumed to be women, in absence of careful osteological assessment, were found to be genetically male. These discoveries challenge longstanding interpretations, such as associating jewelry with femininity or interpreting physical closeness as an indicator of biological relationships. Similarly, the genetic data complicate simple narratives of kinship: at the house of the golden bracelet, which is the only site for which we have genetic data from multiple individuals, the four individuals commonly interpreted as parents and their two children are, in fact, not genetically related. Instead of establishing new narratives that might also misrepresent these people’s lived experiences, these results encourage reflection on conceptions and construction of gender and family in past societies as well as in academic discourse. Furthermore, it is possible that the exploitation of the casts as vehicles for storytelling led to the manipulation of their poses and relative positioning by restorers in the past. Genetic data, together with other bioarcheological approaches, provide the opportunity to deepen our understanding of the people who became victims of the Vesuvius eruption and highlight how integrating genetic data with archaeological and historical information, even in a historically rich site like Pompeii, significantly enhances our understanding of past lives and behaviors.
Resource availability
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Alissa Mittnik (alissa_mittnik@eva.mpg.de).
Materials availability
This study did not generate new unique reagents.
Data and code availability
•
All data needed to evaluate the conclusions in the paper are present in the paper and/or the supplemental information.
•
Newly reported ancient sequencing data have been deposited at European Nucleotide Archive (ENA) and are publicly available as of the date of publication, with the following accession number ENA: PRJEB74999. Haploid genotypes for the 1,240,000 panel for the newly reported ancient individuals and genotype data for the newly reported present-day individuals are available at https://reich.hms.harvard.edu/datasets.
•
This paper does not report original code.
•
Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request.
Acknowledgments
We thank Aisling Kearns, Rebecca Bernardos, Zhao Zhang, Matthew Ferry, Megan Michel, Jonas Oppenheimer, and Kristin Stewardson for support in ancient DNA work, and we thank Domenico Sparice, Michael McCormick, and Solenn Troadec for critical comments to the manuscript. The ancient DNA laboratory work and analysis at Florence was funded by PRIN grant number 2020HJXCK9 of the Ministero dell’Università e della Ricerca Italiano “Pompeii: A Molecular Portrait” to David Caramelli, the European Union grant—Next Generation EU—PNRR M4C2—Investimento 1.3. PE5-Change, and the NBFC Ministero dell’Università e della Ricerca Italiano, PNRR M4C2, “Dalla ricerca all’impresa,” Investimento 1.4, Project CN00000033. D.R. is an Investigator of the Howard Hughes Medical Institute (HHMI), and the ancient DNA laboratory work and analysis at Harvard were also supported by National Institutes of Health grant HG012287, John Templeton Foundation grant 61220, the Allen Discovery Center program (which is a Paul G. Allen Frontiers Group advised program of the Paul G. Allen Family Foundation), and a gift from J.-F. Clin. We thank Dr. Brendan J. Culleton for conducting radiocarbon dating at Pennsylvania State University. Strontium ratios were measured via TIMS, with assistance from Drs. Ann Heatherington and George Kamenov, and oxygen and carbon isotope ratios were measured by Dr. Jason Curtis. This article is subject to HHMI’s Open Access to Publications policy. HHMI lab heads have previously granted a nonexclusive CC BY 4.0 license to the public and a sublicensable license to HHMI in their research articles. Pursuant to those licenses, the author-accepted manuscript of this article can be made freely available under a CC BY 4.0 license immediately upon publication.
Author contributions
E.P., S.V., D.C., D.R., and A. Mittnik designed the research. E.P., S.V., S. Morelli, M.L., A. Modi, M.A.D., D.J.K., R.J.G., J.K., N.R., S. Mallick, and A. Mittnik performed the research. E.P., S.V., D.J.K., R.J.G., J.K., S. Mallick, and A. Mittnik analyzed data. V.A., G.Z., and M.O. assembled archaeological material and context. E.P., S.V., V.C.M., D.C., D.R., and A. Mittnik wrote the paper.
Declaration of interests
The authors declare no competing interests.
STAR★Methods
Key resources table
REAGENT or RESOURCE SOURCE IDENTIFIER
Biological samples
Ancient skeletal element This study I3678; Cast Number 15
Ancient skeletal element This study I3679; Cast Number 1
Ancient skeletal element This study I3680; Cast Number 79
Ancient skeletal element This study I3681; Cast Number 20
Ancient skeletal element This study I3682; Cast Number 25
Ancient skeletal element This study I3683; Cast Number 50
Ancient skeletal element This study I3684; Cast Number 21
Ancient skeletal element This study I3685; Cast Number 52
Ancient skeletal element This study I3686; Cast Number 51
Ancient skeletal element This study I3687; Cast Number 14
Ancient skeletal element This study I3688; Cast Number 54
Ancient skeletal element This study I3689; Cast Number 62
Ancient skeletal element This study I3690; Cast Number 22
Ancient skeletal element This study I3691; Cast Number 53
Chemicals, peptides, and recombinant proteins
Distilled Water DNA free, UltraPure Thermo Fisher Scientific Cat# 10977035
0.5 M EDTA pH 8.0 Thermo Fisher Scientific Cat# AM9261
Proteinase K Thermo Fisher Scientific Cat# AM2548
Isopropanol Sigma Aldrich Cat# I9516
Guanidine hydrochloride Sigma Aldrich Cat# G4505
Sodium Acetate Solution (3 M), pH 5.2 Thermo Fisher Scientific Cat# R1181
Tween 20 Sigma Aldrich Cat# P2287
Buffer PE Qiagen Cat# 19065
Buffer PB Qiagen Cat# 19066
Tris-EDTA buffer solution Sigma Aldrich Cat# 93283
UltraPure 0.5M EDTA, pH 8.0 Thermo Fisher Scientific Cat# 15575020
NEB Buffer #2 10x New England Biolabs Cat# B7002
ATP 10 mM New England Biolabs Cat# P0756
BSA 20 mg/mL New England Biolabs Cat# B9000
dNTP Mix Euroclone Cat# EMR415001
USER enzyme New England Biolabs Cat# M5505
Uracil Glycosylase inhibitor (UGI) New England Biolabs Cat# M0281
T4 Polynucleotide Kinase New England Biolabs Cat# M0201
T4 DNA Polymerase New England Biolabs Cat# M0203
Bst DNA Polymerase New England Biolabs Cat# M0537L
Quick Ligase New England Biolabs Cat# M2200
PfuTurbo Cx Hotstart DNA Polymerase Agilent Technologies Cat# 600414
Ethanol Merck Cat# 1009831000
Agilent D1000 ScreenTapes Agilent Technologies Cat# 5067-5582
Agilent D1000 Reagents Agilent Technologies Cat# 5067-5583
Agilent HS Screen Tapes Agilent Technologies Cat# 5067-5584
Agilent HS Reagents Agilent Technologies Cat# 5067-5585
Agarose Lonza Cat# 50004
Expand Long Range dNTPack Roche Cat# 4829034001
Quick Blunting Kit New England BioLaba Cat# E1201
AccuPrime Pfx DNA Polymerase Thermo Fisher Scientific Cat# 12344024
Herculase II Fusion DNA Polymerase Agilent Technologies Cat# 600679
Sodium hydroxide Pellets Fisher Scientific Cat# 10306200
Dynabeads M-270 Streptavidin Thermo Fisher Scientific Cat# 65305
AmpliTaq Gold DNA Polymerase with Gold Buffer and MgCl2 Thermo Fisher Scientific Cat# 4311806
Agilent aCGH Hybridization Kit Agilent Cat# 5188-5220
5M NaCl Sigma Aldrich Cat# S5150
1M NaOH Sigma Aldrich Cat# 71463
1 M Tris-HCl pH 8.0 Sigma Aldrich Cat# AM9856
Quantifiler Trio DNA Quantification Kit Thermo Fisher Scientific Cat# 4482910
Cot-1 DNA Invitrogen Cat# 15279011
Dynabeads MyOne Streptavidin T1 Thermo Fisher Scientific Cat# 65602
Salmon sperm DNA Thermo Fisher Scientific Cat# 15632-011
Denhardt’s solution Sigma-Aldrich Cat# D9905-5Ml
20x SCC Buffer Thermo Fisher Scientific Cat# AM9770
2x HI-RPM hybridization buffer Agilent Cat# 5118-5380
Critical commercial assays
MinElute PCR Purification Kit QIAGEN Cat# 28006
QIAquick PCR Purification Kit QIAGEN Cat# 28104
Qubit dsDNA HS Assay Kit, 500 assays Thermo Fisher Scientific Cat# Q32854
High Pure Extender Assembly from the Roche High Pure Viral Nucleic Acid Large Volume Kit,40 reactions Roche Cat# 5114403001
QIAquick Nucleotide Removal Kit Quiagen Cat# 28304
MiSeq Reagent Kit v3 (150 cycle) Illumina Cat# MS-102-3001
NextSeq 500/550 High Output Kit v2.5 Illumina Cat# 20024906
Deposited data
Sequencing data from 5 newly reported ancient individuals This study ENA: PRJEB74999
Genotype data from 5 ancient newly reported individuals This study https://reich.hms.harvard.edu/datasets
Oligonucleotides
IS1_adapter.P5: A∗C∗A∗C∗TCTTTCCCTACACGACG
CTCTTCCG∗A∗T∗C∗T		 Meyer and Kircher Merck
IS2_adapter.P7: G∗T∗G∗A∗CTGGAGTTCAGACGTG
TGCTCTTCCG∗A∗T∗C∗T		 Meyer and Kircher Merck
IS3_adapter.P5+P7: A∗G∗A∗T∗CGGAA∗G∗A∗G∗C Meyer and Kircher Merck
IS6: CAAGCAGAAGACGGCATACGA Meyer and Kircher Merck
IS5: AATGATACGGCGACCACCGA Meyer and Kircher Merck
Sol_iPCR-MPI: CAAGCAGAAGACGGCATACG
AGAT∗∗∗∗∗∗∗∗GTGACTGGAGTTCAGACGTGT		 Kircher et al. Merck
P5_iPCR-LP: AATGATACGGCGACCACCGAGAT
CTACAC∗∗∗∗∗∗∗∗ACACTCTTTCCCTACACGACGCTCTT		 Kircher et al. Merck
Bio-T: Biotin-TCAAGGACATCC∗G Maricic et al. Merck
B: CGGATGTCCTT∗G Maricic et al. Merck
BO1.P5.F: AATGATACGGCGACCACCGAGATCTA
CACTCTTTCCCTACACGACGCTCTT
CCGATCT-phosphate		 Maricic et al. Merck
BO2.P5.R: AGATCGGAAGAGCGTCGTGTAGGGA
AAGAGTGTAGATCTCGGTGGTCGCCG
TATCATT-phosphate		 Maricic et al. Merck
BO3.P7.part1.F: AGATCGGAAGAGCACACG
TCTGAACTCCAGTCAC-phosphate		 Maricic et al. Merck
BO4.P7.part1.R: GTGACTGGAGTTCAGACG
TGTGCTCTTCCGATCT-phosphate		 Maricic et al. Merck
BO5.P7.part2.F: ATCTCGTATGCCGTCTTC
TGCTTG-phosphate		 Maricic et al. Merck
BO6.P7.part2.R: CAAGCAGAAGACGGCA
TACGAGAT-phosphate		 Maricic et al. Merck
BO8.P5.part1.R:GTGTAGATCTCGGTGGTC GCCGTATCATT-Phosphate Fu et al.; Fu et al. Sigma-Aldrich
BO10.P5.part2.R:AGATCGGAAGAGCGTC
GTGTAGGGAAAGAGTGT-phosphate		 Fu et al.; Fu et al. Sigma-Aldrich
Sol_bridge_P5: AATGATACGGCGACCACCGA Maricic et al. Merck
Sol_bridge_P7: CAAGCAGAAGACGGCATACGA Maricic et al. Merck
LongR_mt1_For: GGCTTTCTCAACTTTTAAAGGATA Meyer et al. Merck
LongR_mt1_Rev: TGTCCTGATCCAACATCGAG Meyer et al. Merck
LongR_mt2_For: CCGTGCAAAGGTAGCATAATC Meyer et al. Merck
LongR_mt2_Rev: TTACTTTTATTTGGAGTTGCACCA Meyer et al. Merck
Probe for 1240K Panel Haak et al.; Mathieson et al. N/A
Software and algorithms
EAGER version 1.92.55 Peltzer et al. https://github.com/apeltzer/EAGER-GUI
CircularMapper version 1.0 Peltzer et al. https://github.com/apeltzer/CircularMapper/releases
Dedup v0.12.07 Peltzer et al. https://github.com/apeltzer/DeDup
bwa v. 0.7.17-r1188 Li and Durbin https://github.com/lh3/bwa
mapDamage2.0 Jónsson et al. https://ginolhac.github.io/mapDamage/
contamMix Fu et al. N/A
Haplogrep3 Schönherr et al. https://haplogrep.i-med.ac.at
HID Real-Time PCR Analysis Software v1.2 Thermo Fisher A24664
SeqPrep 1.1 https://github.com/jstjohn/SeqPrep N/A
Preseq Daley and Smith N/A
ANGSD Korneliussen et al. N/A
SAMTools Li and Durbin N/A
EIGENSOFT (version 7.2.1). https://github.com/DReichLab/EIG N/A
ADMIXTOOLS v.6.0 https://github.com/dReichLab/AdmixTools N/A
KIN Popli et al. N/A
BREADR Rohrlach et al. N/A
sexDetERRmine Lamnidis et al. N/A
ADMIXTURE Alexander et al. N/A
hapROH Ringbauer et al. N/A
Experimental model and subject details
Plaster casts
In 79 CE the Mount Somma eruption that led to the formation of Vesuvius destroyed Pompeii and killed most of the population. As the people slowly died from the painful hot and lethal gases and/or ash, they were covered with pumice and ash. Subsequently, the rainfall caused the bodies to become cemented in the ash and while the soft tissues decomposed, the hardened ash preserved the outline of the bodies. The impressive excavations to unearth the Pompeii city began in 1748 and proceeded sporadically, until the archaeologist Giuseppe Fiorelli began to carry out the research systematically, keeping detailed records of all the findings. In 1863 Fiorelli set up a method to realize plaster casts on some of the victims of the eruption, pouring liquid chalk into the voids left by the bodies in the hardened ash. This method allowed to recreate the shape of the bodies even with their expression at the time of death (Figure S1). Plaster casts were made for 104 of the estimated approximately 1000 victims found in Pompeii.
Sampled ancient individuals
During the recent efforts of cast restoration at the Pompeii Archaeological Park, we had the possibility to collect bone fragments and teeth from inside the casts. The skeletal samples were accessible through damaged parts of the casts, and they showed different degrees of preservation. In some cases, the bone material was mixed with plaster and highly fragmented and fragile (Figure S1). The casts which were sampled were excavated at seven locations within Pompeii (Table S1). A first set of samples (Set 1: Cast Numbers 21, 22, 50, 51, 52 and 53) from six individuals from the House of Cryptoporticus and the House of the Golden Bracelet were chosen for molecular analysis to verify whether the reconstruction of the relations between them made on an archaeological basis was supported. Later on a further set of samples from eight additional individuals (Set 2) was collected (Table S1).
Method details
Sampling of skeletal material and DNA extraction
Sampling, DNA extraction and library preparation of all specimens was carried out in the Molecular Anthropology Unit of the University of Florence, a state-of-the-art facility dedicated to the analysis of ancient DNA samples. To remove potential contamination, the outer layer of the bone fragments and teeth was mechanically removed using a rotary sanding tool (Dremel 300 series). After brushing, each sample was irradiated by ultraviolet light (λ = 254 nm) for 45min in a Biolink DNA Crosslinker (Biometra). DNA was extracted from approximately 50 mg of powder collected from the bones or from the tooth root following a protocol designed for optimizing the retrieval of very short DNA fragments in highly degraded samples.
DNA library preparation
Illumina NGS libraries were constructed starting from 20 μl of DNA extract each, following a double-stranded DNA protocol using a unique combination of two indexes per specimen. Libraries without any UDG treatment were made for Set 1, to allow for assessment of the deamination patterns as a criterium of authenticity. We produced libraries with partial-UDG treatment for all the 14 samples for screening and potential 1240K SNP capture. Negative controls were checked with both qPCR and Agilent 2100 Bioanalyzer DNA 1000 chip. After adapter ligation blanks had a concentration of 4–5 order lower than the biological samples, while indexing PCR products showed the presence of adapter-indexes dimers only.
Mitochondrial DNA capture and sequencing
At the University of Florence, the non-UDG-treated libraries of Set 1, along with extraction and library blanks, were enriched for mitochondrial DNA following a multiplexed capture protocol and sequenced on an Illumina MiSeq instrument for 2×76+8+8 cycles. After demultiplexing, raw sequence data were analyzed using a pipeline specific for ancient DNA samples, using the following tools implemented in the pipeline. Adapters were clipped-off and paired-end reads with a minimum overlap of 10 bp merged in a single sequence using Clip&Merge version 1.7.4. Merged reads were then mapped on the revised Cambridge Reference Sequence, rCRS (GenBank: NC_012920) by CircularMapper in order to take into account the circularity of the mitochondrial genome. Duplicates were removed using DeDup, a tool that considers both ends of the fragments to recognize them as clonal. Reads with mapping quality below 30 were discarded.
Mapping results of these samples are shown in Table S3. Samples 22, 50, 51, 52, and 53 presented a mean coverage of 55.39, 37.34, 3.43 40.82, and 69.85 respectively, with more than 99% of the mitochondrial genome covered at least by 5 sequences with the exception of sample 51 with lower coverage (more than 80% of the mitochondrial genome covered at least by 2 sequences). No usable data was obtained for sample 21.
Second mitochondrial DNA capture, autosomal capture and sequencing
We screened aliquots of all 14 prepared partial-UDG-treated libraries as well as three extraction and library blanks at the ancient DNA facilities of Harvard Medical School, Boston MA, USA, by in-solution hybridization, enriching for the mitochondrial genome, along with about 3,000 nuclear SNPs using a previously described bead-based capture, with probes replaced by amplified oligonucleotides synthesized by CustomArray Inc. After the capture, we completed the adapter sites using PCR, attaching dual index combinations to each enriched library. We sequenced the screening products on an Illumina NextSeq500 using v.2 150 cycle kits for 2 × 76 cycles and 2 × 7 cycles. Screening results are summarized in Data S1A.
For the seven libraries that passed the screening performed at Harvard Medical School, we performed 1240K capture, using two rounds of in-solution enrichment on the targeted set of 1,237,207 SNPs using previously reported protocols., After indexing the enrichment products in a way that assigned a unique index combination to each library, we sequenced the enriched products on an Illumina NextSeq500 instrument using v.2 150 cycle kits for 2 × 76 cycles and 2 × 7 cycles.
Quantification and statistical analysis
Quantification and evaluation of DNA preservation
DNA extracts of Set 1 were quantified in duplicate at the University of Florence, to obtain a preliminary description of the molecular preservation of such peculiar material. The presence of inhibitors and the DNA degradation level were evaluated using the Quantifiler Trio DNA Quantification Kit (Thermo Fisher Scientific, Oyster Point, CA). Real-time PCR amplification reactions contained 10.5 μL of Primer-Probe Mix, 12.5 μL of Master Mix, and 2.0 μL of the DNA sample as per the user’s manual. The data were analyzed using the HID Real-Time PCR Analysis Software v1.2 with the settings provided. The quantification results are summarized in Table S2. No results were obtained from sample 21 for all targets analyzed. The quantification values obtained from samples 22 and 50 were zero for the large autosomal target, presumably due to DNA degradation in too-short fragments. Similar results were achieved for the Y marker in which the concentration varied between 2.8 and 107 pg/μl for all five samples. Positive results for the Y marker suggested that the samples were male. Because no results were obtained for the large autosomal marker from the two samples, the degradation index (DI) measuring typical ancient DNA contamination could only be computed reliably for samples 52, 53, and 51. The estimated DI values for these samples were 19.2, 7.6, and 14.8, respectively. As reported in the user manual, these DI values indicate that the DNA in the samples was moderately/significantly degraded, consistent with authentic ancient DNA. No significant shift from the non-template control in IPC CT was observed, indicating that if inhibition was present, it was not enough to suppress IPC amplification significantly.
Processing of sequencing data
We trimmed barcodes and adapters from the raw sequences and merged read pairs with at least 10 or 15 overlapping base pairs according to the length of the sequenced reads and mapped the resulting reads to the human reference genome, hg19 [GRCh37] using the samse command of BWA (version 0.6.1).
Four samples provide complete or nearly complete mitochondrial genomes after the mtDNA target enrichment performed on non-UDG-treated libraries prepared in Florence on the first batch of six samples collected. We assessed the authenticity of these mitochondrial genomes by examining the characteristic aDNA damage patterns and confirming a single source for mitochondrial sequences using contamMix (Table S3). The consensus sequences of the individuals were uploaded to Haplogrep3 to determine mtDNA haplogroups. Mitochondrial haplogroups were also determined for the data obtained from the partial UDG-treated libraries on all the 14 samples through Haplogrep3. For the samples processed in both laboratories, the mitochondrial profiles obtained from the two different library protocols were compared and provided further support to the authenticity of the data.
We determined genetic sex on the 1240K capture data using sexDetERRmine. Of the seven individuals that passed screening, we were able to determine that five were genetically male (consistent with one X and one Y chromosome and inconsistent with two XX chromosomes and no Y chromosome), while two individuals remained indeterminate due to low coverage (Data S1A). Damage patterns as assessed with MapDamage 2.0 were lower than in the data generated in the mtDNA capture performed in Florence, which is expected due to the partial UDG-treatment used on the 1240K capture libraries (Table 1). Sex estimates remained constant within the resolution of the confidence intervals after retaining only reads with C-to-T and G-to-A misincorporations at the 5’ and 3’ ends, respectively, using pmdtools v0.60 (Data S1A). We estimated heterozygosity on the X-chromosome of males using ANGSD. For two males with sufficient coverage of at least 200 informative SNPs on the X chromosome we estimated nuclear contamination rates below 4%.
The individuals with working data had a median coverage on the 1240K SNP set of 0.054 (range 0.006 – 0.437). We prepared a genotype dataset for population genetic analysis by using mapped sequences with two bases trimmed from se ends by choosing one allele at random at the 1240K capture sites and retained five individuals for analysis that had at least 10,000 SNPs covered at least once (range 53,739 – 364,533). Results are summarized in Data S1A.
We assigned Y-chromosomal haplogroups according to the Yfull 8.09 phylogeny using all trimmed reads mapped to the Y chromosome and report the most downstream diagnostic SNPs (Data S1C).
Population genetic and relatedness analysis
We compiled a reference dataset consisting of whole genome data from 2,674 ancient individuals as well as previously reported whole-genome sequencing data from 346 worldwide modern-day individuals,,, and merged the five newly reported pseudo-haploid genotypes from Pompeii.
We merged this dataset with 3,291 modern-day individuals from 109 worldwide populations genotyped on the Affymetrix Human Origins (HO) SNP.,,,,, We used the smartpca function of EIGENSOFT (57) to perform principal component analysis (PCA) using default parameters, with the settings lsqproject:YES and numoutlier:0. We projected the ancient individuals onto a PCA plot of 1196 modern-day West Eurasian individuals, and 1,900 modern-day worldwide individuals, restricting to the HO set of 597,573 SNPs.
We performed clustering using unsupervised ADMIXTURE, after pruning SNPs in linkage disequilibrium with one another with PLINK using the parameter —indep-pairwise 200 25 0.4, which left us with 282,184 SNPs. We performed an ADMIXTURE analysis for values of k between 2 and 15, carrying out 5 replicates at each value of k and retaining the highest likelihood replicate at each k (Figures S2 and S3).
We performed qpWave,/qpAdm analyses with default parameters and allsnps: YES, precomputing f-statistics with using qpfstats (https://github.com/DReichLab/AdmixTools/blob/master/qpfs.pdf). All tools are implemented in ADMIXTOOLS. As “right” outgroups we used a set of 9 populations: “OldAfrica” (a diverse set of ancient African individuals with no evidence of West Eurasian-related admixture,,), MAR_Taforalt_EpiP (Epipaleolithic North Africans), RUS_AfontovaGora3 (Mesolithic hunter-gatherer from Siberia), RUS_EHG (Hunter-gatherers from north-eastern Europe,), GEO_CHG.SG (hunter-gatherer from the Caucasus), WHGB (Hunter-gatherers from the eastern Baltic and the Balkans,), ISR_Natufian_EpiP (Levantine Epipaleolithic hunter-gatherers), TUR_EpiPal_Pinarbasi (an Anatolian Epipaleolithic hunter-gatherer) and TUR_C_Boncuklu_PPN (Anatolian pre-ceramic farmers). As distal source populations we used TUR_Marmara_Barcin_N (North-Western Anatolian Neolithic farmers), Mediterranean_CA_NorthAfrican (two individuals from Chalcolithic Iberia and Sardinia with fully North African ancestry,), WHGA (hunter-gatherers from Western and Central Europe,,,,,), Levant_PPN (Levantine pre-ceramic farmers), Steppe_EMBA (pastoralists from the Pontic-Caspian steppes associated with the Yamnaya and Poltavka cultural complexes,,), and IRN_Ganj_Dareh_N (Neolithic farmers from the Zagros region,). In the modeling using proximal source populations,,,,,,,,,,,,,,,,, we replaced GEO_CHG.SG with IRN_Ganj_Dareh_N in the outgroups so as to avoid a batch effect of attraction between sources and outgroups produced with the same processing strategy. We additionally added TUR_Marmara_Barcin_N and Steppe_EMBA to the outgroups and applied a “competitive” approach, adding unused sources to the outgroups. Corresponding genetic IDs for all outgroups and source groups are listed in Data S2A and results of qpAdm modeling are found in Data S2B and S2C.
We estimated relatedness between the Pompeian individuals using KIN, with default parameters, and BREAD R specifying a distance of at least 50,000 bp between overlapping sites. Results are shown in Data S1D.
We used hapROH on the individual covered at more than 350,000 SNPs to detect Runs of Homozygosity (Figure S4).
Prediction of phenotypic traits
We explored the genomic data for the five previously selected individuals to predict phenotypic traits related to diseases, and externally visible characteristics (EVCs). We collected information about genetically determined medical conditions available in SNPedia (https://www.snpedia.com/index.php/Category:Is_a_medical_condition updated in October 2023) and sorted in ten macro-areas (Data S3). A total of 94477 SNPs were selected. Then we look for these conditions in GWAS catalog (https://www.ebi.ac.uk/gwas/) for a further description of traits and the list of the genomic variants involved in each trait (Data S3A and S3B). BCFTools (v. 1.10.2) with the mpileup function was used to generate a VCF file containing genotype likelihoods in the selected positions for the previous alignment (BAM) files, setting a minimum mapping (-q) and base (-Q) quality thresholds of 20. In general, we obtained a maximum coverage of 3x for the selected SNPs, with most of them covered 1x. The obtained variants were annotated through SNPnexus (https://www.snp-nexus.org/v4/).
For the analysis of phenotypic traits related to externally visible characteristics (EVCs), 41 SNPs were obtained from the HIrisPlex-S panel and are related to eye, hair, and skin pigmentation (Data S3A and S3B). The same approach described for the disease-linked traits was used to select these variants. Subsequently, the obtained variants related to the SNPs in the HIrisPlex-S panel were analyzed using the R software script provided for the HIrisPlex-S system, which allowed us to convert the results into the format required for the Hirsiplex-S online prediction model.
The variants involved in diseases genotyped for each sample are listed in Data S3C–S3G. As shown in this table, several risk alleles have been detected for different diseases, but due to the low coverage and the presence of only a few risk alleles for each disease investigated, no pathological traits could be predicted with certainty. An example of this can be represented by individual 53 who, of the four risk alleles identified for Kawasaki disease, has only two. Skin, eye and hair colors are the only traits for which a prediction is possible, and it was possible to attest that individual 52 had black hair and dark skin, and individuals 25, 51 and 53 had brown eyes (Data S3D–S3G).
Strontium, Carbon, and Oxygen Analysis
Sample processing of the Pompeii tooth (Individual 25, lower premolar) took place in the Bone Chemistry Lab, Department of Anthropology, University of Florida, and all mass spectrometry was conducted in the Department of Geological Sciences, University of Florida. A small chunk of tooth enamel from Individual 25 (UF BCL 4300) was removed from the crown using an NSK dental drill and a Dedeco separating disc. The tooth enamel ‘chunk’ (∼30 mg) removed was cleaned of adhering debris and dentine under a dissecting microscope, using a mounted dental drill apparatus outfitted with a carbide tungsten tapered drill bit. Two chunks of ‘cleaned’ tooth enamel (∼10 mg each) were produced, one for carbon and oxygen isotope ratios using isotope ratio mass spectrometry (IRMS), and the second for strontium isotope analysis using thermal ionization mass spectrometry (TIMS).
A 10 mg sample targeted for carbon and oxygen isotope analysis was ground using an acid-cleaned agate set and tooth enamel powder was loaded into a pre-weighed 0.5 mL microcentrifuge tube. To oxidize the sample, a 2% sodium hypochlorite (NaCIO) solution was added to the sample for ∼8 hours, rinsed to neutral with Milli-Q water, followed by ∼8 hours of pretreatment using 0.2M acetic acid (CH3COOH). The pretreated sample was then rinsed to neutral with Milli-Q and the sample was placed in a -20° C freezer. Once frozen, the sample was freeze-dried for ∼48 hours, and its final weight recorded prior to sample loading for IRMS. Carbon and oxygen stable isotope ratios were measured in duplicate on Sept. 6, 2017 via IRMS (Finnigan MAT 252) using a Kiel III carbonate prep device. The precision of NBS-19 standards (n=10) during the run for δ13C was 0.02‰ and for δ18O was 0.07‰.
Another 10 mg sample was targeted for radiogenic strontium ratios was transferred to a class 1000 Clean Lab in the Department of Geological Sciences, University of Florida. The tooth enamel chunk was dissolved in 50% nitric acid (HNO3) on a hot plate (100° C) for 24 hours in a pre-cleaned and capped Teflon vial. Vials were opened and evaporated to dryness, prior to ion chromatography. The dried residue was dissolved in 3.5 N HNO3 and loaded onto a cation exchange column packed with strontium-spec resin (Eichrom Technologies, Inc.) to separate the strontium from other ions. The Sr sample was then loaded onto a degassed tungsten filament and 87Sr/86Sr was measured on a Micromass Sector 54 TIMS. The sample was run for 200+ ratios at 1.5 V and normalized to 86Sr/88Sr = 0.1194 following methods outlined in Hodell et al., against repeated analyses of the standard reference NBS-987. Obtained isotope measurements were compared against values in the literature.,,,,, The results of the stable isotope analysis are found in Figure 4.
Supplemental information (5)
PDF (7.86 MB)
Document S1. Figures S1–S4 and Tables S1–S3
Spreadsheet (50.02 KB)
Data S1. Supporting data for sampling, sample processing, and data description, related to STAR Methods
(A) Overview of sample metainformation, processing and library statistics.
(B) Results of AMS radiocarbon dating.
(C) Y-chromosomal haplogroup assignments.
(D) Results of relatedness analyses using BREADR and KIN.
Spreadsheet (68.37 KB)
Data S2. Supporting data for population genetic analysis, related to STAR Methods
(A) Individuals included in qpAdm analysis and their population labels.
(B) Results of qpAdm modeling using distal source populations, related to Figure 3.
(C) Results of qpAdm modeling using proximal source populations, shown are working models with p ≥ 0.01.
(D) Results of qpAdm modeling of Individual 52 using proximal source populations.
Spreadsheet (699.06 KB)
Data S3. Supporting data for phenotypic and disease risk assessment, related to STAR Methods
(A) Phenotype probabilities assessed with the HIrisPlex-S system.
(B) List of markers used for assessment of phenotypic traits and disease risks.
(C) Genotyping results for disease risk markers, individual 22.
(D) Genotyping results for disease risk markers, individual 25.
(E) Genotyping results for disease risk markers, individual 51.
(F) Genotyping results for disease risk markers, individual 52.
(G) Genotyping results for disease risk markers, individual 53.
PDF (10.65 MB)
Document S2. Article plus supplemental information
References
1.
Amato, V. ∙ Covolan, M. ∙ Dessales, H. …
Seismic Microzonation of the Pompeii Archaeological Park (Southern Italy): Local Seismic Amplification Factors

Geosciences. 2022; 12:275

Crossref
Scopus (2)
Google Scholar
2.
De Carolis, E. ∙ Patricelli, G. ∙ Ciarallo, A.
Rinvenimenti di corpi umani nell’area urbana di Pompei

Riv. di Stud. Pompeiani. 1998; 9:75-123

Google Scholar
3.
De Carolis, E. ∙ Patricelli, G.
Le vittime dell’eruzione
Oplontis, P.E. ∙ D’Ambrosio, A. ∙ Guzzo, P.G. …
Storie di un’eruzione
Mondadori Electa, 2003
Google Scholar
4.
Luongo, G. ∙ Perrotta, A. ∙ Scarpati, C. …
Impact of the AD 79 explosive eruption on Pompeii, II. Causes of death of the inhabitants inferred by stratigraphic analysis and areal distribution of the human casualties

J. Volcanol. Geotherm. Res. 2003; 126:169-200

Crossref
Scopus (76)
Google Scholar
5.
Lazer, E.
Resurrecting Pompeii

Routledge, 2009

Crossref
Scopus (43)
Google Scholar
6.
Lazer, E. ∙ Welch, K. ∙ Vu, D. …
Inside the casts of the Pompeian victims: Results from the first season of the Pompeii Cast Project in 2015

Pap. Br. Sch. Rome. 2021; 89:101-136

Crossref
Scopus (3)
Google Scholar
7.
Cipollaro, M. ∙ Di Bernardo, G. ∙ Galano, G. …
Ancient DNA in human bone remains from Pompeii archaeological site

Biochem. Biophys. Res. Commun. 1998; 247:901-904

Crossref
Scopus (39)
PubMed
Google Scholar
8.
Di Bernardo, G. ∙ Del Gaudio, S. ∙ Galderisi, U. …
2000 year-old ancient equids: an ancient-DNA lesson from Pompeii remains

J. Exp. Zool. Pt. B. 2004; 302B:550-556

Crossref
Scopus (10)
Google Scholar
9.
Di Bernardo, G. ∙ Galderisi, U. ∙ Del Gaudio, S. …
Genetic characterization of Pompeii and Herculaneum Equidae buried by Vesuvius in 79 AD

J. Cell. Physiol. 2004; 199:200-205

Crossref
Scopus (17)
PubMed
Google Scholar
10.
Guarino, F.M. ∙ Buccelli, C. ∙ Graziano, V. …
Recovery and amplification of ancient DNA from Herculaneum victims killed by the 79 AD Vesuvius hot surges

Turk. J. Biol. 2017; 41:640-648

Crossref
Scopus (4)
Google Scholar
11.
Di Bernardo, G. ∙ Del Gaudio, S. ∙ Galderisi, U. …
Ancient DNA and Family Relationships in a Pompeian House

Ann. Hum. Genet. 2009; 73:429-437

Crossref
Scopus (11)
PubMed
Google Scholar
12.
Cipollaro, M. ∙ Di Bernado, G. ∙ Forte, A. …
Histological analysis and ancient DNA amplification of human bone remains found in Caius Iulius Polybius house in Pompeii

Croat. Med. J. 1999; 40:392-397

PubMed
Google Scholar
13.
Di Bernardo, G. ∙ Del Gaudio, S. ∙ Cammarota, M. …
Enzymatic repair of selected cross-linked homoduplex molecules enhances nuclear gene rescue from Pompeii and Herculaneum remains

Nucleic Acids Res. 2002; 30, e16

Crossref
Scopus (32)
PubMed
Google Scholar
14.
Manca, P. ∙ Farina, V. ∙ Gadau, S. …
Phenotypic features of the domestic pigs bred in the Roman settlements of Pompeii and Caralis

Ital. J. Anat. Embryol. 2004; 109:105-114

PubMed
Google Scholar
15.
Cipollaro, M.
Strengthening ancient mtDNA equid sequences from Pompeii

J. Cell. Biochem. 2011; 112:363-364

Crossref
Scopus (3)
PubMed
Google Scholar
16.
Gurney, S.M.R.
Revisiting ancient mtDNA equid sequences from Pompeii

J. Cell. Biochem. 2010; 111:1080-1081

Crossref
Scopus (4)
PubMed
Google Scholar
17.
Corbino, C.A. ∙ Comegna, C. ∙ Amoretti, V. …
Equine exploitation at Pompeii (AD 79)

J. Archaeol. Sci. Rep. 2023; 48, 103902

Crossref
Scopus (2)
Google Scholar
18.
Scorrano, G. ∙ Viva, S. ∙ Pinotti, T. …
Bioarchaeological and palaeogenomic portrait of two Pompeians that died during the eruption of Vesuvius in 79 AD

Sci. Rep. 2022; 12:6468

Crossref
Scopus (9)
PubMed
Google Scholar
19.
Antonio, M.L. ∙ Gao, Z. ∙ Moots, H.M. …
Ancient Rome: A genetic crossroads of Europe and the Mediterranean

Science. 2019; 366:708-714

Crossref
Scopus (129)
PubMed
Google Scholar
20.
Mathieson, I. ∙ Alpaslan-Roodenberg, S. ∙ Posth, C. …
The genomic history of southeastern Europe

Nature. 2018; 555:197-203

Crossref
Scopus (439)
PubMed
Google Scholar
21.
Osanna, M. ∙ Capurso, A. ∙ Masseroli, S.M.
I Calchi di Pompei da Giuseppe Fiorelli ad Oggi

L’Erma di Bretschneider, 2021

22.
Maricic, T. ∙ Whitten, M. ∙ Pääbo, S.
Multiplexed DNA sequence capture of mitochondrial genomes using PCR products

PLoS One. 2010; 5, e14004

Crossref
Scopus (408)
PubMed
Google Scholar
23.
Haak, W. ∙ Lazaridis, I. ∙ Patterson, N. …
Massive migration from the steppe was a source for Indo-European languages in Europe

Nature. 2015; 522:207-211

Crossref
Scopus (0)
PubMed
Google Scholar
24.
Lazaridis, I. ∙ Alpaslan-Roodenberg, S. ∙ Acar, A. …
The genetic history of the Southern Arc: A bridge between West Asia and Europe

Science. 2022; 377, eabm4247

Crossref
Scopus (50)
Google Scholar
25.
Battaglia, V. ∙ Fornarino, S. ∙ Al-Zahery, N. …
Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe

Eur. J. Hum. Genet. 2009; 17:820-830

Crossref
Scopus (134)
PubMed
Google Scholar
26.
Trombetta, B. ∙ Cruciani, F. ∙ Sellitto, D. …
A new topology of the human Y chromosome haplogroup E1b1 (E-P2) revealed through the use of newly characterized binary polymorphisms

PLoS One. 2011; 6, e16073

Crossref
Scopus (41)
PubMed
Google Scholar
27.
Mendez, F.L. ∙ Karafet, T.M. ∙ Krahn, T. …
Increased resolution of Y chromosome haplogroup T defines relationships among populations of the Near East, Europe, and Africa

Hum. Biol. 2011; 83:39-53

Crossref
Scopus (43)
PubMed
Google Scholar
28.
Ringbauer, H. ∙ Novembre, J. ∙ Steinrücken, M.
Parental relatedness through time revealed by runs of homozygosity in ancient DNA

Nat. Commun. 2021; 12:5425

Crossref
Scopus (89)
PubMed
Google Scholar
29.
Chaitanya, L. ∙ Breslin, K. ∙ Zuñiga, S. …
The HIrisPlex-S system for eye, hair and skin colour prediction from DNA: Introduction and forensic developmental validation

Forensic Sci. Int. Genet. 2018; 35:123-135

Full Text
Full Text (PDF)
Scopus (192)
PubMed
Google Scholar
30.
Rocco, T.
The House of the Golden Bracelet (VI, 17. 42)
Guzzo, P.G.
Tales from an Eruption: Pompeii, Herculaneum, Oplontis: Guide to the Exhibition
Mondadori Electa, 2003
Google Scholar
31.
Guzzo, P.G.
Tales from an Eruption: Pompeii, Herculaneum, Oplontis Guide to the Exhibition

Electa, 2003

Google Scholar
32.
De Carolis, E. ∙ Patricelli, G.
Impronte Pompeiane

L’Erma di Bretschneider, 2018

Google Scholar
33.
Spinazzola, V.
Di un gruppo di fuggiaschi sepolti nella cenere, e di alcune impronte che se ne trassero
L’Archeologia dell’amore. Dal Neanderthal al Taj Mahal
Neo Edizioni, 1914; 257-263
Google Scholar
34.
Spinazzola, V.
Pompei alla luce degli scavi nuovi di via dell’Abbondanza (anni 1910-1923)

Libreria dello Stato, 1953

Google Scholar
35.
Rando, J.C. ∙ Pinto, F. ∙ González, A.M. …
Mitochondrial DNA analysis of northwest African populations reveals genetic exchanges with European, near-eastern, and sub-Saharan populations

Ann. Hum. Genet. 1998; 62:531-550

Crossref
Scopus (190)
PubMed
Google Scholar
36.
Richards, M. ∙ Macaulay, V. ∙ Hickey, E. …
Tracing European founder lineages in the Near Eastern mtDNA pool

Am. J. Hum. Genet. 2000; 67:1251-1276

Full Text
Full Text (PDF)
Scopus (795)
PubMed
Google Scholar
37.
Maiuri, A.
La Villa dei Misteri

Libreria dello Stato, 1931

Google Scholar
38.
Lugli, F. ∙ Cipriani, A. ∙ Bruno, L. …
A strontium isoscape of Italy for provenance studies

Chem. Geol. 2022; 587, 120624

Crossref
Scopus (34)
Google Scholar
39.
Arienzo, I. ∙ Rucco, I. ∙ Di Vito, M.A. …
Sr isotopic composition as a tool for unraveling human mobility in the Campania area

Archaeol. Anthropol. Sci. 2020; 12:157

Crossref
Scopus (4)
Google Scholar
40.
Killgrove, K. ∙ Montgomery, J.
All Roads Lead to Rome: Exploring Human Migration to the Eternal City through Biochemistry of Skeletons from Two Imperial-Era Cemeteries (1st-3rd c AD)

PLoS One. 2016; 11, e0147585

Crossref
Scopus (70)
PubMed
Google Scholar
41.
Sengeløv, A. ∙ van de Wijdeven, G. ∙ Snoeck, C. …
Understanding the post-Archaic population of Satricum, Italy: A bioarchaeological approach

J. Archaeol. Sci. Rep. 2020; 31, 102285

Crossref
Scopus (7)
Google Scholar
42.
Emery, M.V. ∙ Stark, R.J. ∙ Murchie, T.J. …
Mapping the origins of Imperial Roman workers (1st-4th century CE) at Vagnari, Southern Italy, using (87) Sr/(86) Sr and δ(18) O variability

Am. J. Phys. Anthropol. 2018; 166:837-850

Crossref
Scopus (36)
PubMed
Google Scholar
43.
Zaugg, C. ∙ Guggisberg, M.A. ∙ Vach, W. …
Mapping Strontium Isotope Geographical Variability as a Basis for Multi-regional Human Mobility: The Sybaris Region (S Italy) in the Early 1st Millennium BC

Environ. Archaeol. 2023; 1-19

Crossref
Scopus (1)
Google Scholar
44.
Stark, R.J. ∙ Emery, M.V. ∙ Schwarcz, H. …
Dataset of oxygen, carbon, and strontium isotope values from the Imperial Roman site of Velia (ca. 1st-2nd c. CE), Italy

Data Brief. 2021; 38, 107421

Full Text
Full Text (PDF)
Scopus (1)
PubMed
Google Scholar
45.
Nikita, E. ∙ Mardini, M. ∙ Mardini, M. …
SrIsoMed: An open access strontium isotopes database for the Mediterranean

J. Archaeol. Sci. Rep. 2022; 45, 103606

Crossref
Scopus (6)
Google Scholar
46.
Farese, M. ∙ Soncin, S. ∙ Robb, J. …
The Mediterranean archive of isotopic data, a dataset to explore lifeways from the Neolithic to the Iron Age

Sci. Data. 2023; 10:917

Crossref
Scopus (2)
PubMed
Google Scholar
47.
Meyer, M. ∙ Kircher, M.
Illumina Sequencing Library Preparation for Highly Multiplexed Target Capture and Sequencing

Cold Spring Harb. Protoc. 2010; 2010, pdb.prot5448

Crossref
Scopus (1505)
Google Scholar
48.
Kircher, M. ∙ Sawyer, S. ∙ Meyer, M.
Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform

Nucleic Acids Res. 2012; 40:e3

Crossref
Scopus (0)
PubMed
Google Scholar
49.
Fu, Q. ∙ Meyer, M. ∙ Gao, X. …
DNA analysis of an early modern human from Tianyuan Cave, China

Proc. Natl. Acad. Sci. USA. 2013; 110:2223-2227

Crossref
Scopus (392)
PubMed
Google Scholar
50.
Fu, Q. ∙ Hajdinjak, M. ∙ Moldovan, O.T. …
An early modern human from Romania with a recent Neanderthal ancestor

Nature. 2015; 524:216-219

Crossref
Scopus (506)
PubMed
Google Scholar
51.
Meyer, M. ∙ Stenzel, U. ∙ Myles, S. …
Targeted high-throughput sequencing of tagged nucleic acid samples

Nucleic Acids Res. 2007; 35, e97

Crossref
Scopus (162)
Google Scholar
52.
Mathieson, I. ∙ Lazaridis, I. ∙ Rohland, N. …
Genome-wide patterns of selection in 230 ancient Eurasians

Nature. 2015; 528:499-503

Crossref
Scopus (910)
PubMed
Google Scholar
53.
Peltzer, A. ∙ Jäger, G. ∙ Herbig, A. …
EAGER: efficient ancient genome reconstruction

Genome Biol. 2016; 17:60

Crossref
Scopus (280)
PubMed
Google Scholar
54.
Li, H. ∙ Durbin, R.
Fast and accurate short read alignment with Burrows-Wheeler transform

Bioinformatics. 2009; 25:1754-1760

Crossref
Scopus (33540)
PubMed
Google Scholar
55.
Jónsson, H. ∙ Ginolhac, A. ∙ Schubert, M. …
mapDamage2.0: fast approximate Bayesian estimates of ancient DNA damage parameters

Bioinformatics. 2013; 29:1682-1684

Crossref
Scopus (990)
PubMed
Google Scholar
56.
Fu, Q. ∙ Mittnik, A. ∙ Johnson, P.F. …
A revised timescale for human evolution based on ancient mitochondrial genomes

Curr. Biol. 2013; 23:553-559

Full Text
Full Text (PDF)
Scopus (436)
PubMed
Google Scholar
57.
Schönherr, S. ∙ Weissensteiner, H. ∙ Kronenberg, F. …
Haplogrep 3 – an interactive haplogroup classification and analysis platform

Nucleic Acids Res. 2023; 51:W263-W268

Crossref
Scopus (20)
PubMed
Google Scholar
58.
Daley, T. ∙ Smith, A.D.
Predicting the molecular complexity of sequencing libraries

Nat. Methods. 2013; 10:325-327

Crossref
Scopus (218)
PubMed
Google Scholar
59.
Korneliussen, T.S. ∙ Albrechtsen, A. ∙ Nielsen, R.
ANGSD: Analysis of Next Generation Sequencing Data

BMC Bioinformatics. 2014; 15:356

Crossref
Scopus (0)
PubMed
Google Scholar
60.
Popli, D. ∙ Peyrégne, S. ∙ Peter, B.M.
KIN: a method to infer relatedness from low-coverage ancient DNA

Genome Biol. 2023; 24:10

Crossref
Scopus (24)
PubMed
Google Scholar
61.
Rohrlach, A.B. ∙ Tuke, J. ∙ Popli, D. …
BREADR: An R Package for the Bayesian Estimation of Genetic Relatedness from Low-coverage Genotype Data

Preprint atbioRxiv. 2023;

Crossref
Scopus (0)
Google Scholar
62.
Lamnidis, T.C. ∙ Majander, K. ∙ Jeong, C. …
Ancient Fennoscandian genomes reveal origin and spread of Siberian ancestry in Europe

Nat. Commun. 2018; 9:5018

Crossref
Scopus (82)
PubMed
Google Scholar
63.
Alexander, D.H. ∙ Novembre, J. ∙ Lange, K.
Fast model-based estimation of ancestry in unrelated individuals

Genome Res. 2009; 19:1655-1664

Crossref
Scopus (0)
PubMed
Google Scholar
64.
Ministero per i beni e le Attività Culturali Soprintendenza speciale per i Beni Archeologici di Napoli e Pompei
Uno Alla Volta i Calchi

Mondadori Electra S.p.A, 2010

Google Scholar
65.
Dabney, J. ∙ Knapp, M. ∙ Glocke, I. …
Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments

Proc. Natl. Acad. Sci. USA. 2013; 110:15758-15763

Crossref
Scopus (939)
PubMed
Google Scholar
66.
Rohland, N. ∙ Harney, E. ∙ Mallick, S. …
Partial uracil – DNA – glycosylase treatment for screening of ancient DNA

Philos. Trans. R. Soc. Lond. B Biol. Sci. 2015; 370, 20130624

Crossref
Scopus (314)
PubMed
Google Scholar
67.
Meyer, M. ∙ Fu, Q. ∙ Aximu-Petri, A. …
A mitochondrial genome sequence of a hominin from Sima de los Huesos

Nature. 2014; 505:403-406

Crossref
Scopus (373)
PubMed
Google Scholar
68.
Lazaridis, I. ∙ Nadel, D. ∙ Rollefson, G. …
Genomic insights into the origin of farming in the ancient Near East

Nature. 2016; 536:419-424

Crossref
Scopus (590)
PubMed
Google Scholar
69.
Rohland, N. ∙ Reich, D.
Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture

Genome Res. 2012; 22:939-946

Crossref
Scopus (749)
PubMed
Google Scholar
70.
Thermo Fisher Scientific
Quantifiler™ HP and Trio DNA Quantification Kits User Guide

Life Technologies Limited Company, 2018

Google Scholar
71.
Skoglund, P. ∙ Northoff, B.H. ∙ Shunkov, M.V. …
Separating endogenous ancient DNA from modern day contamination in a Siberian Neandertal

Proc. Natl. Acad. Sci. USA. 2014; 111:2229-2234

Crossref
Scopus (293)
PubMed
Google Scholar
72.
Mallick, S. ∙ Micco, A. ∙ Mah, M. …
The Allen Ancient DNA Resource (AADR) a curated compendium of ancient human genomes

Sci. Data. 2024; 11:182

Crossref
Scopus (39)
PubMed
Google Scholar
73.
Mallick, S. ∙ Li, H. ∙ Lipson, M. …
The Simons Genome Diversity Project: 300 genomes from 142 diverse populations

Nature. 2016; 538:201-206

Crossref
Scopus (885)
PubMed
Google Scholar
74.
Meyer, M. ∙ Kircher, M. ∙ Gansauge, M.-T. …
A high-coverage genome sequence from an archaic Denisovan individual

Science. 2012; 338:222-226

Crossref
Scopus (1305)
PubMed
Google Scholar
75.
Prüfer, K. ∙ Racimo, F. ∙ Patterson, N. …
The complete genome sequence of a Neanderthal from the Altai Mountains

Nature. 2014; 505:43-49

Crossref
Scopus (1461)
PubMed
Google Scholar
76.
Skoglund, P. ∙ Mallick, S. ∙ Bortolini, M.C. …
Genetic evidence for two founding populations of the Americas

Nature. 2015; 525:104-108

Crossref
Scopus (250)
PubMed
Google Scholar
77.
Lazaridis, I. ∙ Mittnik, A. ∙ Patterson, N. …
Genetic origins of the Minoans and Mycenaeans

Nature. 2017; 548:214-218

Crossref
Scopus (161)
PubMed
Google Scholar
78.
Reitsema, L.J. ∙ Mittnik, A. ∙ Kyle, B. …
The diverse genetic origins of a Classical period Greek army

Proc. Natl. Acad. Sci. USA. 2022; 119, e2205272119

Crossref
Scopus (15)
PubMed
Google Scholar
79.
Biagini, S.A. ∙ Solé-Morata, N. ∙ Matisoo-Smith, E. …
People from Ibiza: an unexpected isolate in the Western Mediterranean

Eur. J. Hum. Genet. 2019; 27:941-951

Crossref
Scopus (21)
PubMed
Google Scholar
80.
Jeong, C. ∙ Balanovsky, O. ∙ Lukianova, E. …
The genetic history of admixture across inner Eurasia

Nat. Ecol. Evol. 2019; 3:966-976

Crossref
Scopus (110)
PubMed
Google Scholar
81.
Patterson, N. ∙ Moorjani, P. ∙ Luo, Y. …
Ancient admixture in human history

Genetics. 2012; 192:1065-1093

Crossref
Scopus (0)
PubMed
Google Scholar
82.
Skoglund, P. ∙ Thompson, J.C. ∙ Prendergast, M.E. …
Reconstructing Prehistoric African Population Structure

Cell. 2017; 171:59-71.e21

Crossref
Scopus (0)
PubMed
Google Scholar
83.
Lipson, M. ∙ Sawchuk, E.A. ∙ Thompson, J.C. …
Ancient DNA and deep population structure in sub-Saharan African foragers

Nature. 2022; 603:290-296

Crossref
Scopus (43)
PubMed
Google Scholar
84.
Wang, K. ∙ Goldstein, S. ∙ Bleasdale, M. …
Ancient genomes reveal complex patterns of population movement, interaction, and replacement in sub-Saharan Africa

Sci. Adv. 2020; 6, eaaz0183

Crossref
Scopus (67)
Google Scholar
85.
van de Loosdrecht, M. ∙ Bouzouggar, A. ∙ Humphrey, L. …
Pleistocene North African genomes link near Eastern and sub-Saharan African human populations

Science. 2018; 360:548-552

Crossref
Scopus (122)
PubMed
Google Scholar
86.
Fu, Q. ∙ Posth, C. ∙ Hajdinjak, M. …
The genetic history of Ice Age Europe

Nature. 2016; 534:200-205

Crossref
Scopus (622)
PubMed
Google Scholar
87.
Mittnik, A. ∙ Wang, C.-C. ∙ Pfrengle, S. …
The genetic prehistory of the Baltic Sea region

Nat. Commun. 2018; 9:442

Crossref
Scopus (158)
PubMed
Google Scholar
88.
Jones, E.R. ∙ Gonzalez-Fortes, G. ∙ Connell, S. …
Upper Palaeolithic genomes reveal deep roots of modern Eurasians

Nat. Commun. 2015; 6:8912

Crossref
Scopus (295)
PubMed
Google Scholar
89.
Feldman, M. ∙ Fernández-Domínguez, E. ∙ Reynolds, L. …
Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia

Nat. Commun. 2019; 10:1218

Crossref
Scopus (71)
PubMed
Google Scholar
90.
Olalde, I. ∙ Brace, S. ∙ Allentoft, M.E. …
The Beaker phenomenon and the genomic transformation of northwest Europe

Nature. 2018; 555:190-196

Crossref
Scopus (444)
PubMed
Google Scholar
91.
Fernandes, D.M. ∙ Mittnik, A. ∙ Olalde, I. …
The spread of steppe and Iranian-related ancestry in the islands of the western Mediterranean

Nat. Ecol. Evol. 2020; 4:334-345

Crossref
Scopus (86)
PubMed
Google Scholar
92.
Lipson, M. ∙ Szécsényi-Nagy, A. ∙ Mallick, S. …
Parallel palaeogenomic transects reveal complex genetic history of early European farmers

Nature. 2017; 551:368-372

Crossref
Scopus (243)
PubMed
Google Scholar
93.
Villalba-Mouco, V. ∙ van de Loosdrecht, M.S. ∙ Posth, C. …
Survival of Late Pleistocene Hunter-Gatherer Ancestry in the Iberian Peninsula

Curr. Biol. 2019; 29:1169-1177.e7

Full Text
Full Text (PDF)
Scopus (87)
PubMed
Google Scholar
94.
Rivollat, M. ∙ Jeong, C. ∙ Schiffels, S. …
Ancient genome-wide DNA from France highlights the complexity of interactions between Mesolithic hunter-gatherers and Neolithic farmers

Sci. Adv. 2020; 6, eaaz5344

Crossref
Scopus (85)
PubMed
Google Scholar
95.
Patterson, N. ∙ Isakov, M. ∙ Booth, T. …
Large-scale migration into Britain during the Middle to Late Bronze Age

Nature. 2022; 601:588-594

Crossref
Scopus (81)
PubMed
Google Scholar
96.
Narasimhan, V.M. ∙ Patterson, N. ∙ Moorjani, P. …
The formation of human populations in South and Central Asia

Science. 2019; 365, eaat7487

Crossref
Scopus (387)
PubMed
Google Scholar
97.
Olalde, I. ∙ Mallick, S. ∙ Patterson, N. …
The genomic history of the Iberian Peninsula over the past 8000 years

Science. 2019; 363:1230-1234

Crossref
Scopus (299)
PubMed
Google Scholar
98.
Brunel, S. ∙ Bennett, E.A. ∙ Cardin, L. …
Ancient genomes from present-day France unveil 7,000 years of its demographic history

Proc. Natl. Acad. Sci. USA. 2020; 117:12791-12798

Crossref
Scopus (57)
PubMed
Google Scholar
99.
Schuenemann, V.J. ∙ Peltzer, A. ∙ Welte, B. …
Ancient Egyptian mummy genomes suggest an increase of Sub-Saharan African ancestry in post-Roman periods

Nat. Commun. 2017; 8:15694

Crossref
Scopus (127)
PubMed
Google Scholar
100.
Harney, É. ∙ Cheronet, O. ∙ Fernandes, D.M. …
A minimally destructive protocol for DNA extraction from ancient teeth

Genome Res. 2021; 31:472-483

Crossref
Scopus (38)
PubMed
Google Scholar
101.
Broushaki, F. ∙ Thomas, M.G. ∙ Link, V. …
Early Neolithic genomes from the eastern Fertile Crescent

Science. 2016; 353:499-503

Crossref
PubMed
Google Scholar
102.
Posth, C. ∙ Zaro, V. ∙ Spyrou, M.A. …
The origin and legacy of the Etruscans through a 2000-year archeogenomic time transect

Sci. Adv. 2021; 7, eabi7673

Crossref
Scopus (29)
PubMed
Google Scholar
103.
Aneli, S. ∙ Saupe, T. ∙ Montinaro, F. …
The Genetic Origin of Daunians and the Pan-Mediterranean Southern Italian Iron Age Context

Mol. Biol. Evol. 2022; 39, msac014

Crossref
Scopus (8)
PubMed
Google Scholar
104.
Marcus, J.H. ∙ Posth, C. ∙ Ringbauer, H. …
Genetic history from the Middle Neolithic to present on the Mediterranean island of Sardinia

Nat. Commun. 2020; 11:939

Crossref
Scopus (95)
PubMed
Google Scholar
105.
Allentoft, M.E. ∙ Sikora, M. ∙ Sjögren, K.-G. …
Population genomics of Bronze Age Eurasia

Nature. 2015; 522:167-172

Crossref
Scopus (1010)
PubMed
Google Scholar
106.
Onouchi, Y. ∙ Ozaki, K. ∙ Burns, J.C. …
A genome-wide association study identifies three new risk loci for Kawasaki disease

Nat. Genet. 2012; 44:517-521

Crossref
Scopus (275)
PubMed
Google Scholar
107.
Hodell, D.A. ∙ Quinn, R.L. ∙ Brenner, M. …
Spatial variation of strontium isotopes (87Sr/86Sr) in the Maya region: a tool for tracking ancient human migration

J. Archaeol. Sci. 2004; 31:585-601

Crossref
Scopus (268)
Google Scholar

Tłumaczenie AUTOMATYCZNE:

Starożytne DNA podważa obowiązujące interpretacje odlewów gipsowych z Pompejów

Najważniejsze informacje
• Wygenerowaliśmy dane dotyczące całego genomu z materiału szkieletowego w gipsowych odlewach z Pompejów
• Dane przeczą wcześniejszym narracjom na temat tożsamości i relacji ofiar
 

Pompeje były rzymskim miastem położonym w Kampanii we Włoszech, 14 mil na południowy wschód od Neapolu. Zostało zniszczone przez wybuch wulkanu Somma-Wezuwiusz w 79 r. n.e. Pliniusza, znany również jako „erupcja Pompejów”. Miasto zostało pogrzebane pod osadem pumeksu lapilli, który powstał we wczesnej fazie erupcji, a następnie osadami popiołu z prądów piroklastycznych w późniejszej fazie. Miasto pozostało w dużej mierze zapomniane aż do jego ponownego odkrycia pod koniec XVIII wieku. Jego wyjątkowe zachowanie i wgląd w codzienne życie w Cesarstwie Rzymskim sprawiły, że Pompeje stały się jednym z najbardziej znanych na świecie stanowisk archeologicznych i zostały wpisane na Listę Światowego Dziedzictwa UNESCO. Najwcześniejsze stabilne osady w Zatoce Neapolitańskiej w epoce żelaza (IA) pochodzą z VIII wieku p.n.e., kiedy Oskowie zbudowali domy w pobliżu ujścia rzeki Sarno na niewielkim wzgórzu, reprezentującym pozostałości wielu lokalnych otworów wulkanicznych wznoszących się na otaczającej równinie Sarno.1 Ze względu na strategiczne położenie Pompeje stały się ważnym węzłem drogowym i portowym. Grecy, Etruskowie i Samnici próbowali podbić Pompeje i ostatecznie stały się one kolonią rzymską. Erupcja w 79 r. n.e. całkowicie zniszczyła Pompeje, ale piroklastyczne osady pokrywające miasto zachowały jego budynki, ulice i artefakty. Wiele ciał również zostało zachowanych, podobnie jak dzieła sztuki, biżuteria, zwoje książek i inne kulturowe pozostałości mieszkańców. Podczas wykopalisk rozpoczętych w 1748 r. znaleziono liczne ofiary, zarówno pojedyncze, jak i grupowane, w domach, na placach, w ogrodach i na ulicach tuż za murami miasta.2,3,4,5 W XIX wieku archeolog Giuseppe Fiorelli opracował metodę wykonywania odlewów poprzez wlewanie płynnego gipsu do pustych przestrzeni pozostałych po rozkładzie tkanek miękkich ofiar. Od tego czasu odkryto ponad 1000 ludzkich ofiar wśród ruin miasta, a 104 gipsowe odlewy zachowujące kształty ofiar i otaczające ich kości zostały wykonane przy użyciu metody Fiorelliego. W 2015 r. podczas renowacji 86 odlewów, próba skanowania tomografią komputerową (CT) lub prześwietlenia 26 z nich wykazała, że ​​żaden nie zawierał kompletnych szkieletów. Odlewy były w przeszłości znacznie modyfikowane i prawdopodobnie kreatywnie odrestaurowywane, a różnice stylistyczne między odlewami częściowo odzwierciedlały preferencje estetyczne okresów, w których zostały wykonane.6 Popularne interpretacje tożsamości ofiar w Pompejach są zatem pod wpływem nie tylko archeologów, którzy je jako pierwsi opisali, ale także restauratorów, którzy zdecydowali się udoskonalić lub zmienić niektóre cechy kształtów ciał. Wyniki obrazowania ujawniły w niektórych przypadkach wprowadzenie elementów stabilizujących, takich jak pręty metalowe, a także częste usuwanie kości przed procesem odlewania, co komplikowało ustalenie płci na podstawie osteologicznej. Możliwe było ponowne zinterpretowanie niektórych odlewów, takich jak wcześniej wyobrażony wzdęty brzuch domniemanej kobiety w ciąży, prawdopodobnie utworzony przez pogniecione ubrania. Wiele badań potwierdziło możliwość pobrania danych DNA z szczątków ludzkich i zwierzęcych w Pompejach.7,8,9,10,11,12,13,14,15,16,17 Niedawno dane genetyczne z ludzkich szczątków szkieletowych znalezionych w Casa del Fabbro18 wykazały, że pochodzenie genetyczne tej osoby mieściło się w różnorodności genetycznej obserwowanej w regionie Cesarskiego Rzymskiego Lacjum (współczesne Lacjum), który miał większe wpływy wschodniego Morza Śródziemnego w porównaniu z poprzednim IA.19 Jako port, Pompeje są zazwyczaj postrzegane jako miasto o zróżnicowanej i mobilnej populacji. Analiza bioarcheologiczna ujawniła jednak wysoką częstotliwość cech niemetrycznych, które mogą wskazywać na jednorodność genetyczną lub wspólne wpływy środowiskowe.5 Starożytne DNA i izotopy strontu oferują możliwość lepszego zrozumienia różnorodności i pochodzenia mieszkańców Pompejów. Próbowaliśmy wydobyć informacje genetyczne z ludzkich gipsowych odlewów, wykorzystując wzbogacenie starożytnych ekstraktów DNA o mitochondrialne DNA i ponad milion celów polimorfizmu pojedynczego nukleotydu (SNP).20 Badanie przeprowadzono na silnie rozdrobnionych szczątkach szkieletowych zmieszanych z gipsem odzyskanym z różnych elementów anatomicznych 14 z 86 odlewów poddawanych renowacji. Rysunek S1 przedstawia mapę pokazującą, gdzie znaleziono 14 ofiar i gdzie wykonano odlewy. Naszym celem było przetestowanie interpretacji sugerowanych w przypadku braku danych genetycznych na temat tożsamości ofiar i ich wzajemnych relacji, w oparciu o kształt i położenie ciał, a także wzbogacenie informacji o danych osteologicznych uzyskanych wcześniej za pomocą obrazowania rentgenowskiego i tomografii komputerowej w większości niekompletnych szkieletów w odlewach.6 Takie wnioski ukształtowały sposób, w jaki historycy, archeolodzy i opinia publiczna wyobrażają sobie społeczeństwo tak żywo uwiecznione przez katastrofę. Ponadto zbadaliśmy pochodzenie genetyczne ofiar i porównaliśmy je ze znaną różnorodnością genetyczną współczesnych osób z miasta Rzym i jego zaplecza.

Wyniki i dyskusja

Zachowanie DNA i markery dziedziczone jednostronnie

W poniższej sekcji opisujemy osobniki, używając numerów odlewów21, które są powszechnie używane w literaturze bioarcheologicznej na temat stanowiska.

Odpowiednie identyfikatory genetyczne można znaleźć w Tabeli 1 i Danych S1A.

Pobraliśmy próbki fragmentów kości zmieszanych z gipsem z 14 różnych odlewów (Tabela S1; Rysunek S1) i przeszukaliśmy je, określając stężenie i degradację DNA (Tabela S2), a także stosując podejście oparte na hybrydyzacji w celu wzbogacenia o mitochondrialne DNA22 i 3000 autosomalnych SNP23 (Tabele S3 i S4). Na podstawie wyników przeszukiwania zdecydowaliśmy się wzbogacić siedem bibliotek częściowo poddanych działaniu UDG o około 1,2 miliona jądrowych SNP („1 240 000” zestaw SNP) (Dane S1A). Ponadto przeprowadziliśmy datowanie radiowęglowe czterech z wybranych osobników (Dane S1B). Liczba rzutów Identyfikator genetyczny Miejsce odkrycia SNP z 1 240 000 pokrytych zestawów Średnie pokrycie na 1 240 000 zestawach SNP Płeć genetyczna Kwantyfikator Trio Cel Y Haplogrupa Y Haplogrupa mtDNA C-do-T na końcu 5′ (biblioteka nie-UDG) C-do-T na końcu 5′ (biblioteka UDG) Oszacowanie zanieczyszczenia chromosomu X ANGSD: Liczba SNP Oszacowanie zanieczyszczenia chromosomu X ANGSD: Średnia Oszacowanie zanieczyszczenia chromosomu X ANGSD: C.I. 22 I3690 Dom Cryptoporticus 93 727 0,09 M M J2b2a1 N1b1a1 0,3 0,09 19 N/A N/A 25 I3682 Willa Tajemnic 53 739 0,047 M N/Aa E1b1b1b1b H N/A 0,1 0 N/A N/A 50 I3683 Dom Złotej Bransolety N/A N/A N/A M N/A H1h1 0,23 N/A N/A N/A N/A 51 I3686 Dom Złotej Bransolety 62 030 0,054 M M J2a1a4b T2c1c 0,15 0,04 4 N/A N/A 52 I3685 Dom Złotej Bransolety 364 533 0,437 M M T1a1a1b2b2b1a U1a1 0,2 0,02 350 0,0187 0–0,039 53 I3691 Dom Złotej Bransolety 286 023 0,309 M M E1b1b H 0,24 0,04 208 0,0086 0–0,026 Tabela 1 Podsumowanie wyników genetycznych Zobacz także Rysunek S1. a Kwantyfikacja nie została przeprowadzona Otwórz tabelę w nowej karcie Pięć próbek dostarczyło kompletnych lub częściowych genomów mitochondrialnych, ze wzorcami błędnych inkorporacji zasad na końcach odczytu typowymi dla starożytnego DNA (Tabela S3) i zostało pokrytych co najmniej 50 000 docelowych autosomalnych SNP, przy czym mediana pokrycia 1 240 000 SNP wahała się od 0,006× do 0,437× (Tabela 1; Dane S1A). Wszystkie pięć osób (Rysunek 1) zostało genetycznie określonych jako płeć męska, co oceniono na podstawie kwantyfikacji DNA przy użyciu zestawu Quantifiler Trio Kit (STAR ​​Methods). Oszacowaliśmy również zanieczyszczenie chromosomu X dla dwóch osób, dla których istniały wystarczające dane do przeprowadzenia tej kwantyfikacji i stwierdziliśmy, że było ono poniżej 4%. W pozostałych przypadkach wzór uszkodzeń molekularnych i szacunki skażenia dostarczone przez dane mitochondrialne (tabele 1 i S3; dane S1A) wskazują, że wyniki są zgodne z autentycznym starożytnym DNA pochodzącym od pojedynczego osobnika. Wszystkie osobniki zostały określone jako należące do linii chromosomu Y (J2a, J2b, E1b i T1a), które pojawiły się po raz pierwszy w Azji Zachodniej i do dziś występują w najwyższych częstotliwościach w Azji Zachodniej i Środkowej, Europie Południowej i Afryce Północnej20,24,25,26,27 (dane S1C). Żaden z osobników nie miał dowodów na pokrewieństwo do trzeciego stopnia (dane S1D). Rysunek 1 Odlewy gipsowe z Pompejów i ich pierwotne lokalizacje w Pompejach Pokaż pełny podpisPrzeglądarka rysunków Odlewy gipsowe reprezentują populację o zróżnicowanym pochodzeniu Odkryliśmy, że pięć osobników jest przesuniętych od współczesnych Włochów, a także populacji włoskich z okresu IA i późnej IA oraz okresu imperialnego Etrusków na podstawie analizy głównych składowych (PCA) skonstruowanej na współczesnych populacjach zachodniej Eurazji i Afryki Północnej oraz populacjach światowych. Zamiast tego skupiają się bardziej z populacjami wschodniego Morza Śródziemnego, Lewantynu i Afryki Północnej (rysunki 2A i 2B). Ten wzór jest podobny do wzoru znalezionego dla populacji Cesarstwa Rzymskiego w centralnej Italii19 i wcześniej opublikowanego pojedynczego osobnika z Pompejów z danymi obejmującymi cały genom, którego współwykreśliliśmy z pięcioma osobnikami z nowo wygenerowanymi danymi.18 W niemonitorowanej analizie ADMIXTURE przy k = 6 (rysunki 2C, S2 i S3), osobniki z Pompejów różnią się od mniej więcej współczesnych osobników związanych z kulturą etruską pod względem proporcji składników pochodzenia zmaksymalizowanych u mezolitycznych europejskich łowców-zbieraczy (niższy u Pompejów), jak również u łowców-zbieraczy z Kaukazu (wyższy u Pompejów), co sprawia, że ​​skład ich pochodzenia jest bardziej podobny do składu przodków Rzymian z centralnej Italii, a także współczesnych osobników z Morza Egejskiego i Anatolii. Osobnik 52 wykazuje skład przodków porównywalny do osobników lewantyńskich z okresu IA i rzymskiego, charakteryzujący się niewielkim komponentem zmaksymalizowanym w populacjach współczesnej Afryki Subsaharyjskiej i brakiem komponentu zmaksymalizowanego u europejskich łowców-zbieraczy. Ten osobnik najbardziej ściśle grupuje się z populacjami lewantyńskimi. Rysunek 2 Analiza głównych komponentów i analiza domieszek Pokaż pełny podpisPrzeglądarka rysunków Aby określić ilościowo wkład różnych źródeł pochodzenia, przetestowaliśmy różne modele 2- i 3-drożne przy użyciu qpAdm i raport działających modeli przy użyciu najmniejszej liczby źródeł, z p > 0,01 i współczynnikami poniżej 1 (Dane S2A i S2B). Używając dystalnego zestawu domniemanych populacji przodków, znaleźliśmy działające modele dla wszystkich osobników (Rysunek 3). W przypadku każdej osoby z odlewów, przodkowie spokrewnieni z rolnikami z okresu neolitu anatolijskiego (TUR_Marmara_Barcin_N) i/lub lewantyńscy rolnicy z okresu neolitu przedceramicznego (Levant_PPN) stanowią największą wnioskowaną proporcję (48%–75%), podczas gdy druga co do wielkości proporcja jest wnioskowana jako pochodząca od osób spokrewnionych z neolitycznymi rolnikami z Iranu (IRN_Ganj-Dareh_N) (26%–45%), z wyjątkiem osoby 25, którą można modelować jako wywodzącą 65,3% ± 4,5% swoich przodków od rolników z Levant_PPN i 34,7% ± 4,5% od pasterzy stepowych z epoki brązu (Steppe_EMBA), źródła przodków wymaganego przez żadną z pozostałych osób. Ten model wskazuje, pomimo niskiego pokrycia genomu danej osoby, na inną historię przodków obejmującą źródła europejskie, które nie przyczyniły się do powstania innych osób. Rysunek 3 Dystalne modele qpAdm Pokaż pełny podpisPrzeglądarka rysunków Osoby 22 i 51 można opisać jako składające się w około 62%–69% z przodków neolitycznych rolników z Anatolii (TUR_Marmara_Barcin_N) i 31%–38% z przodków neolitycznych rolników z Iranu (IRN_Ganj-Dareh_N). Wnioskuje się, że osobnik 52 nie ma przodków neolitycznych rolników z Anatolii (TUR_Marmara_Barcin_N). Zamiast tego można go modelować jako wywodzącego 57,7% ± 3,1% i 42,3% ± 3,1% swoich przodków odpowiednio od rolników z Levant_PPN i neolitycznych rolników z Iranu (IRN_Ganj-Dareh_N). Wynik ten potwierdza ściślejsze grupowanie tej osoby z współczesnymi osobami lewantyńskimi w analizie PCA i ADMIXTURE (Rysunek 3) i sugeruje niedawne pochodzenie lewantyńskie dla niej lub jej bezpośrednich przodków. Dwa alternatywne modele 3-drożne nie są odrzucane dla osoby 53. W obu przypadkach największy odsetek pochodzenia jest wyjaśniony przez kombinację komponentów pochodzących od neolitycznych rolników z Iranu (IRN_Ganj-Dareh_N) i neolitycznych rolników z Anatolii (TUR_Marmara_Barcin_N) — odpowiednio 69%–88% i 84%–97%. Trzeci komponent pochodzi albo od neolitycznych rolników z Lewantu (Levant_PPN) z 21,2% ± 7,1%, albo od osób chalkolitycznych o północnoafrykańskim pochodzeniu (Mediterranean_CA_NorthAfrican) z 9,8% ± 2,8%. Przetestowaliśmy również osoby jako potencjalnie pochodzące z bardziej zbliżonych źródeł, składających się z osób z końca II p.n.e. do początku I tysiąclecia n.e. z różnych regionów zachodniej Eurazji i Afryki Północnej, które w ramach swojej grupy są stosunkowo jednorodne genetycznie zgodnie z PCA (dane S2C i S2D). Modele robocze (p > 0,01) w dużej mierze wymagają populacji wschodniego Morza Śródziemnego, Lewantynu lub Afryki Północnej jako głównego źródła (dane S2C). Modele z przodkami nieodróżnialnymi od jednego ze źródeł, Turkey_West i Turkey_Central, działają dla osoby 22 i osoby 51. Modele robocze 2-drożne dla osoby 25 obejmują wschodnie źródło śródziemnomorskie, które przyczyniło się do większości przodków, w połączeniu ze źródłem bałkańskim, środkowośródziemnomorskim lub środkowoeuropejskim. Podobnie, osobnik 53 może być dopasowany jedynie jako mieszanka źródeł pochodzenia, z trzema testowanymi modelami, ∼80% Turcja_Centralna z 20% Sardynia_Punic, ∼67% Turcja_Wschód z ∼33% Sardynia_Punic i ∼80% Liban z ∼20% Włochy_IA (osoby IA z Półwyspu Apenińskiego), wszystkie pasujące do danych. Nie znaleziono żadnego działającego modelu 1- lub 2-drożnego dla osobnika 52, ale wszystkie wykonalne modele z najwyższymi wartościami p (pomiędzy 1,64e−3 i 2,321e−6) zawierają Egipt jako źródło przyczyniające się do większości pochodzenia (∼51%–73%), co sugeruje, że rzeczywiste źródło jest genetycznie podobne do tego reprezentowanego przez osoby hellenistycznego Egiptu (dane S2D). Wcześniej opublikowany indywidualny f1R wymaga dla wszystkich modeli roboczych około 73%–84% ze źródła libańskiego, w połączeniu ze źródłem europejskim. Charakterystyka demograficzna i fenotypowa Tylko osobnik 52 dostarczył wystarczających danych genetycznych, aby wykryć serie homozygotyczności (ROH), co może dać wgląd w efektywną wielkość populacji i praktyki małżeńskie.28 U tego osobnika znaleziono tylko pojedynczy krótki ROH o długości 4,71 cM (rysunek S4), co jest niezgodne z blisko spokrewnionymi rodzicami lub małą populacją pochodzenia, w której osobniki mają wyraźne pokrewieństwo w tle. Ogólnie rzecz biorąc, heterogeniczność genetyczna widoczna w próbce genomów z Pompejów i brak długich ROH u jednego osobnika są zgodne z dużą, zróżnicowaną populacją, co sugeruje jej rola jako portu rzecznego i opis jako złożonej z różnych lokalnych i imigranckich grup kulturowych przez starożytnych autorów.5 Stanowi to pewne wsparcie dla hipotezy, że wysokie częstotliwości niektórych cech niemetrycznych zaobserwowane u ofiar erupcji w 79 r. n.e. mogą wynikać ze wspólnych zmiennych środowiskowych w trakcie etapów rozwoju, a nie ze wspólnego tła genetycznego. Jednak wśród osobników, które badaliśmy genetycznie, tylko osobnik 22 wykazywał takie wspólne cechy niemetryczne, a konkretnie obecne stosunkowo dużych kosteczek słuchowych w kościach lambda i Wormia w szwie lambdoidalnym.5 Celowane analizy genetyczne osób z takimi cechami i bez nich mogą ujawnić poziom jednorodności w pochodzeniu wśród tych pierwszych. Markery fenotypowe dla widocznych zewnętrznie cech, oceniane za pomocą systemu HIrisPlex-S,29 sugerują najwyższe prawdopodobieństwo brązowych oczu u osób 25, 51 i 53 oraz ciemnej skóry i czarnych włosów u osoby 52 (dane S3A). We wszystkich analizowanych próbkach wykryto kilka alleli ryzyka związanych z różnymi chorobami, ale niskie pokrycie i możliwa interakcja między genotypem a środowiskiem nie pozwoliły nam przewidzieć żadnej z tych cech z pewnością (dane S3B–S3G). Połączone ustalenia genetyczne i osteologiczne przeczą niektórym z ustalonych popularnych narracji Naukowcy, jak również wyobraźnia opinii publicznej, interpretowali wrażenia dotyczące pozycji ciała i kształtu w gipsowych odlewach na różne sposoby, spekulując na temat tożsamości ofiar i ich potencjalnych powiązań ze sobą. Kiedy w 2015 r. rozpoczęto renowację i badanie odlewów za pomocą nowych podejść naukowych, nie było żadnych recenzowanych odniesień osteologicznych dostarczających rzetelnych danych do charakterystyki poszczególnych osób, a jedynymi dostępnymi informacjami były te dostarczone przez archeologów. Niemniej jednak niektóre interpretacje dotyczące płci i relacji między osobami znalazły szerokie uznanie wśród społeczności naukowców i opinii publicznej, rozprzestrzeniając się za pośrednictwem wystaw muzealnych oraz materiałów edukacyjnych i reklamowych. Dlatego też zintegrowanie naszych nowo zgłoszonych danych genetycznych i izotopowych pozwala nam ponownie przyjrzeć się niektórym szeroko rozpowszechnionym interpretacjom. Dom złotej bransolety Dom złotej bransolety znajduje się w Insula 17, Regio VI (Rysunek 1). Nowatorska i złożona forma architektoniczna domu wynikała z połączenia rzymsko-italskiego modelu domu atrium i willi podmiejskiej. Zbudowany na trzech poziomach, wykorzystywał mury miejskie i zbocze wzgórza. Jego pokoje były rozmieszczone tarasowo na trzech poziomach w pozycji panoramicznej. Dom był szczególnie bogaty, a kolorowe freski zdobiły jego ściany. W 1974 roku odkryto cztery ofiary w bliskim sąsiedztwie na miejscu zbrodni i zinterpretowano je jako stanowiące genetycznie spokrewnioną rodzinę.30 Pierwsze trzy ofiary znaleziono u podnóża schodów prowadzących do ogrodu i nabrzeża: dwie osoby dorosłe (osoby 50 i 52) i małe dziecko (osoba 51), najwyraźniej stojące na biodrze osoby 52. ​​Osobę 52 tradycyjnie interpretowano jako kobietę i matkę ze względu na skojarzenie z dzieckiem i misterną złotą bransoletkę o wyjątkowej wadze (6,1 g) noszoną na jednym ramieniu, która również dała domowi nazwę. Drugi dorosły, osobnik 50, został zinterpretowany jako ojciec w genetycznie spokrewnionej grupie rodzinnej. Na podstawie ograniczonej analizy rentgenowskiej oszacowano, że osobniki 50, 51 i 52 to odpowiednio młody dorosły, 5-6-latek i młodszy dorosły w średnim wieku, ale nie można było jednoznacznie przypisać płci żadnego z dorosłych ani dziecka.6 Zasugerowano, że te trzy ofiary szukały schronienia na klatce schodowej i zostały zabite przez schody, które się zawaliły, gdy próbowały uciec z domu do portu miejskiego.30 Kilka metrów dalej znaleziono ciało dziecka w wieku około 4 lat (osobnik 53), zinterpretowane jako chłopiec z powodu wybrzuszenia w tynku w okolicy narządów płciowych.30 Dziecko to zostało prawdopodobnie oddzielone od grupy rodzinnej podczas ucieczki korytarzem prowadzącym do ogrodu. Kwantyfikacja DNA pozwoliła nam oszacować płeć molekularną wszystkich osobników, chociaż identyfikacja płci na podstawie analizy genomu jądrowego była możliwa tylko dla trzech osobników (wszystkich oprócz osobnika 50). Wszystkie osobniki zostały określone jako genetycznie męskie, w tym domniemana dorosła kobieta (osoba 52). Co więcej, zarówno mitochondrialne DNA, jak i dane z całego genomu nie wykazały żadnych dowodów na pokrewieństwo biologiczne, przynajmniej do trzeciego stopnia, między żadnym z osobników, co fałszuje dominującą narrację o tych czterech ofiarach jako genetycznie spokrewnionej rodzinie. Zachowanie materiału genetycznego u dorosłego osobnika 50 pozwoliło nam zrekonstruować tylko genom mitochondrialny, nie wykazując żadnych powiązań matrylinearnych z pozostałymi trzema osobnikami, chociaż nie możemy wykluczyć, że mógł być z nimi spokrewniony na poziomie jądrowym. Analizy PCA i ADMIXTURE pokazują znaczną zmienność w rozmieszczeniu tych trzech osobników w obrębie różnorodności genetycznej zaobserwowanej u włoskich mieszkańców Cesarstwa Rzymskiego (rysunek 2).19 Skład genetyczny przodków trzech osobników wywnioskowany przez qpAdm wydaje się odrębny zarówno w modelowaniu dystalnym, jak i proksymalnym (dane S2), co sugeruje, że ich przodkowie pochodzili z różnych populacji wschodniego Morza Śródziemnego lub Afryki Północnej.

Próba rekonstrukcji wyglądu tych osobników

wnioskując po fenotypach na podstawie genotypów, odkryliśmy, że osobnik 52 miał czarne włosy i ciemną skórę, podczas gdy byliśmy w stanie potwierdzić tylko kolor oczu osobników 51 i 53, który był brązowy (Data S3A).

Dom kryptoporticusa

Dom kryptoporticusa znajduje się w Insula 6, Regio I (Rysunek 1). Dom został pierwotnie zbudowany w III wieku p.n.e. Swoją obecną nazwę zawdzięcza kryptoporticusowi, podziemnemu przejściu z otworami, biegnącemu wzdłuż trzech boków czworokątnego ogrodu otwierającego się na południe. Otwiera się na niego salon (oecus) i cztery termalne pomieszczenia kąpielowe (apodyterium, frigidarium, tepidarium i calidarium, przy czym to ostatnie poprzedza praefurnium). Kryptoportikus pierwotnie miał sklepienia kolebkowe i krzyżowe, a ściany oecus były ozdobione serią scen inspirowanych Iliadą, co stanowi jeden z najwspanialszych przykładów malarstwa pompejańskiego z ostatniego etapu drugiego stylu (epoka Augusta). Ściany czterech pokojów kąpielowych były również pomalowane wykwintnymi obrazami scenicznymi. Podczas wykopalisk w 1914 r. w ogrodzie przed domem znaleziono dziewięć osobników, ale udało się wykonać odlewy tylko czterech z nich. Spośród tych czterech osobników, dwa (osobniki 21 i 22) znaleziono blisko siebie, w tym, co zinterpretowano jako uścisk (ryc. 1), a archeolodzy wysunęli hipotezę, że mogły to być dwie siostry, matka i córka, lub kochanki.21,31,32,33,34 Tomografia komputerowa elementów szkieletu zachowanych w odlewach pozwoliła oszacować wiek osobnika 21 na 14–19 lat, a osobnika 22 na młodego dorosłego. Oszacowanie płci kostnej nie było możliwe, ale odnotowano względną grację czaszki osobnika 22.6

Analiza genetyki jądrowej zakończyła się sukcesem tylko w przypadku osobnika 22 i wykazała, że ​​był mężczyzną, wykluczając możliwość, że para ofiar była siostrami lub matką i córką. Podobnie jak wszystkie inne analizowane próbki, osobnik ten mieści się w śródziemnomorskiej zmienności genetycznej jądra, z przodkami zgodnymi z ówczesnymi populacjami anatolijskimi (dane S2C) i nosi mitochondrialną haplogrupę N1b1a1, prawdopodobnie z bliskowschodniego/północnoafrykańskiego pochodzenia.35,36

Rekonstrukcja genomu mitochondrialnego zakończyła się sukcesem również w przypadku osobnika 21 (dane S1), który nosi dwa pochodne SNP odrębnej haplogrupy R i żadnego z pochodnych SNP prowadzących do N1b1a1, co jest zgodne z brakiem pokrewieństwa matczynego między tymi dwoma osobnikami.

Willa tajemnic Ta willa, która została po raz pierwszy wykopana w latach 1909–1910 i jest nadal przedmiotem drobnych badań wynikających z obaw o ochronę i konserwację, znajduje się na północny zachód od murów miejskich, w pobliżu starożytnego brzegu morza (ryc. 1). Większość jego ścian, sufitów, a w szczególności fresków przetrwała wybuch Wezuwiusza w dużej mierze nienaruszona. Nazwa (Villa dei Misteri) pochodzi od serii fresków datowanych na I wiek p.n.e., przedstawiających rytuał prawdopodobnie poświęcony Bachusowi, bogu wina, płodności i religijnej ekstazy. Willa była bardzo duża, z wieloma różnymi pokojami i przestrzeniami funkcjonalnymi, co było powszechne w przypadku wielu rzymskich willi z tego okresu. Prasa do wina została znaleziona i odrestaurowana w jej oryginalnym miejscu, co odzwierciedla fakt, że zamożne rodziny często produkowały własne wino, oliwę z oliwek i inne produkty, ponieważ większość willi obejmowała część gruntów rolnych. Ciała dwóch dorosłych, interpretowanych jako kobiety, i dziecka znaleziono w złożu pumeksu lapilli, co wskazuje, że zostali złapani we wczesnej fazie erupcji na górnym piętrze części rolniczej i spadli na dolne piętro. Sześć ciał znaleziono w nakładających się złożach popiołu, co wskazuje, że przetrwali pierwszą fazę erupcji. Wśród nich osobnik 25 został znaleziony sam w pokoju, leżący na warstwie popiołu, z żelaznym pierścieniem z wygrawerowanym karneolem kobiecej figurki na małym palcu lewej ręki, pięcioma brązowymi monetami i biczem jako przedmiotami osobistymi37 (Rysunek S1).

Odlew tej ofiary pokazuje niektóre z najlepiej zachowanych szczegółów anatomicznych i tekstylnych. Mężczyzna miał około 1,85 m wzrostu, był szczupły, z wypukłym grzbietem nosa. Zgodnie ze śladami na jego ubraniach i ozdobach miał należeć do niskiej klasy społecznej i został zinterpretowany jako dozorca willi, który wiernie pozostał na swoim stanowisku.21 Nasza analiza genetyczna potwierdza oszacowanie płci męskiej i mieszane pochodzenie genetyczne, które prawdopodobnie można prześledzić zarówno do źródeł wschodniośródziemnomorskich, jak i europejskich (Dane S2C). Aby dowiedzieć się więcej o pochodzeniu geograficznym tego osobnika i jego mobilności życiowej, przeprowadziliśmy analizę izotopów strontu i tlenu (Rysunek 4). Chociaż pomiar strontu (87Sr/86Sr = 0,7084729 ± 0,00001) jest wyższy niż wartości uzyskane w Pompejach (μ = 0,70806, n = 2),38 wartość ta jest zgodna z zakresem biodostępnego Sr występującym na południowej równinie Kampanii (rysunek 4A [0,7075–0,7085]39). Jest to wartość poza lokalnym zasięgiem jaką opisano w rzymskiej populacji Lacjum40,41 i regionach w północnych i południowych Włoszech.38,42,43 Skład szkliwa δ18O (δ18O VSMOW = 26,77‰, δ18O VPDB = −4,03‰) jest zgodny z przybrzeżnymi rozkładami wartości δ18O w centralnej części Półwyspu Apenińskiego (rysunek 4B).38,42,44 Powinowactwa izotopowe z biodostępnymi 87Sr/86Sr i δ18O w centralnej części Półwyspu Apenińskiego potencjalnie wskazują na wczesne zamieszkiwanie w Pompejach i ich okolicach; jednakże, chociaż ta ocena sugeruje lokalne pochodzenie, które mieści się w oczekiwanych lokalnych zakresach, podobieństwa w geologicznych i biodostępnych systemach izotopowych można znaleźć w całym Morzu Śródziemnym.45,46 Rysunek 4 Analiza strontu i tlenu u osobnika 25 z willi tajemnic

Oprócz podkreślenia kosmopolityzmu i mobilności, które ukształtowały populacje miejskie Cesarstwa Rzymskiego, badanie to ilustruje, jak mało wiarygodne mogą być narracje oparte na ograniczonych dowodach, często odzwierciedlając światopogląd badaczy w tamtym czasie. W tym świetle analiza genetyczna może znacznie wzbogacić te narracje, gdy zostanie zintegrowana z danymi archeologicznymi. Na przykład w dwóch analizowanych przez nas willach osoby wcześniej uważane za kobiety, w przypadku braku starannej oceny osteologicznej, okazały się genetycznie płci męskiej. Odkrycia te podważają długotrwałe interpretacje, takie jak kojarzenie biżuterii z kobiecością lub interpretowanie bliskości fizycznej jako wskaźnika biologicznych pokrewieństw. Podobnie dane genetyczne komplikują proste narracje pokrewieństwa: w domu złotej bransolety, który jest jedynym miejscem, dla którego mamy dane genetyczne od wielu osób, cztery osoby powszechnie interpretowane jako rodzice i ich dwójka dzieci nie są w rzeczywistości spokrewnione genetycznie. Zamiast tworzyć nowe narracje, które mogłyby również błędnie przedstawiać doświadczenia życiowe tych osób, wyniki te zachęcają do refleksji nad koncepcjami i konstrukcją płci i rodziny w dawnych społeczeństwach, a także w dyskursie akademickim.

Ponadto możliwe jest, że wykorzystywanie odlewów jako nośników opowieści doprowadziło do manipulacji ich pozami i względnym pozycjonowaniem przez restauratorów w przeszłości. Dane genetyczne, wraz z innymi podejściami bioarcheologicznymi, dają możliwość pogłębienia naszej wiedzy na temat ludzi, którzy stali się ofiarami wybuchu Wezuwiusza i podkreślają, w jaki sposób integrowanie danych genetycznych z informacjami archeologicznymi i historycznymi, nawet w historycznie bogatym miejscu, takim jak Pompeje, znacznie zwiększa nasze zrozumienie przeszłych żyć i zachowań.

Dostępność zasobów Kontakt główny

Więcej informacji i próśb o zasoby i odczynniki należy kierować do głównego kontaktu Alissy Mittnik (alissa_mittnik@eva.mpg.de), który je spełni.

Dostępność materiałów Niniejsze badanie nie wygenerowało nowych unikalnych odczynników.

Dostępność danych i kodów

• Wszystkie dane potrzebne do oceny wniosków zawartych w artykule znajdują się w artykule i/lub w informacjach uzupełniających.

• Nowo zgłoszone dane dotyczące sekwencjonowania starożytnego zostały złożone w Europejskim Archiwum Nukleotydów (ENA) i są publicznie dostępne od daty publikacji, z następującym numerem akcesyjnym ENA: PRJEB74999.

Genotypy haploidalne dla panelu 1 240 000 nowo zgłoszonych osobników starożytnych i dane dotyczące genotypów nowo zgłoszonych osobników współczesnych są dostępne na stronie https://reich.hms.harvard.edu/datasets.

• Niniejszy artykuł nie zgłasza oryginalnego kodu.

• Wszelkie dodatkowe informacje wymagane do ponownej analizy danych zgłoszonych w tym dokumencie roboczym są dostępne na żądanie u głównego kontaktu. Podziękowania Dziękujemy Aisling Kearns, Rebecce Bernardos, Zhao Zhang, Matthew Ferry, Megan Michel, Jonasowi Oppenheimerowi i Kristin Stewardson za wsparcie w pracach nad starożytnym DNA, a także Domenico Sparice, Michaelowi McCormickowi i Solenn Troadec za krytyczne uwagi do manuskryptu. Prace laboratoryjne i analiza starożytnego DNA we Florencji zostały sfinansowane przez grant PRIN nr 2020HJXCK9 Ministero dell’Università e della Ricerca Italiano „Pompeii: A Molecular Portrait” dla Davida Caramelli, grant Unii Europejskiej — Next Generation EU — PNRR M4C2 — Investmento 1.3. PE5-Change i NBFC Ministero dell’Università e della Ricerca Italiano, PNRR M4C2, „Dalla ricerca all’impresa,” Investimento 1.4, Project CN00000033. D.R. jest badaczem Howard Hughes Medical Institute (HHMI), a prace laboratoryjne i analiza starożytnego DNA na Harvardzie były również wspierane przez grant National Institutes of Health HG012287, grant John Templeton Foundation 61220, program Allen Discovery Center (który jest programem Paul G. Allen Frontiers Group doradzanym przez Paul G. Allen Family Foundation) oraz darowiznę od J.-F. Clin. Dziękujemy dr Brendanowi J. Culletonowi za przeprowadzenie datowania radiowęglowego na Pennsylvania State University. Współczynniki strontu mierzono za pomocą TIMS, przy pomocy dr. Ann Heatherington i George Kamenov, a stosunki izotopów tlenu i węgla zostały zmierzone przez dr Jasona Curtisa.

…

Artykuł podlega polityce HHMI Open Access to Publications. Kierownicy laboratoriów HHMI udzielili wcześniej niewyłącznej licencji CC BY 4.0 publicznie i licencji podlicencjonowalnej HHMI w swoich artykułach badawczych. Zgodnie z tymi licencjami zaakceptowany przez autora rękopis tego artykułu może być udostępniony bezpłatnie na licencji CC BY 4.0 natychmiast po opublikowaniu. Wkład autorów E.P., S.V., D.C., D.R. i A. Mittnik zaprojektowali badania. E.P., S.V., S. Morelli, M.L., A. Modi, M.A.D., D.J.K., R.J.G., J.K., N.R., S. Mallick i A. Mittnik przeprowadzili badania. E.P., S.V., D.J.K., R.J.G., J.K., S. Mallick i A. Mittnik przeanalizowali dane. V.A., G.Z. i M.O. zebrali materiał archeologiczny i kontekst. E.P., S.V., V.C.M., D.C., D.R. i A. Mittnik napisali artykuł.
Deklaracja interesów Autorzy deklarują brak konfliktów interesów.
Metody STAR★ Tabela kluczowych zasobów IDENTYFIKATOR ODCZYNNIKA lub ŹRÓDŁA ZASOBU
Próbki biologiczne Starożytny element szkieletu To badanie I3678; Numer odlewu 15 Starożytny element szkieletu To badanie I3679; Numer odlewu 1 Starożytny element szkieletu To badanie I3680; Numer odlewu 79 Starożytny element szkieletu To badanie I3681; Numer odlewu 20 Starożytny element szkieletowy To badanie I3682; Numer odlewu 25 Starożytny element szkieletowy To badanie I3683; Numer odlewu 50 Starożytny element szkieletowy To badanie I3684; Numer odlewu 21 Starożytny element szkieletowy To badanie I3685; Numer odlewu 52 Starożytny element szkieletowy To badanie I3686; Numer odlewu 51 Starożytny element szkieletowy To badanie I3687; Numer odlewu 14 Starożytny element szkieletowy To badanie I3688; Numer odlewu 54 Starożytny element szkieletowy To badanie I3689; Numer odlewu 62 Starożytny element szkieletowy To badanie I3690; Numer odlewu 22 Starożytny element szkieletowy To badanie I3691; Numer odlewu 53 Substancje chemiczne, peptydy i białka rekombinowane Woda destylowana wolna od DNA, UltraPure Thermo Fisher Scientific nr kat. 10977035 0,5 M EDTA pH 8,0 Thermo Fisher Scientific nr kat. AM9261 Proteinaza K Thermo Fisher Scientific nr kat. AM2548 Izopropanol Sigma Aldrich nr kat. I9516 Chlorowodorek guanidyny Sigma Aldrich nr kat. G4505 Roztwór octanu sodu (3 M), pH 5,2 Thermo Fisher Scientific nr kat. R1181 Tween 20 Sigma Aldrich nr kat. P2287 Bufor PE Qiagen nr kat. 19065 Bufor PB Qiagen nr kat. 19066 Roztwór buforowy Tris-EDTA Sigma Aldrich nr kat. 93283 UltraPure 0,5 M EDTA, pH 8.0 Thermo Fisher Scientific nr kat. 15575020 NEB Buffer nr 2 10x New England Biolabs nr kat. B7002 ATP 10 mM New England Biolabs nr kat. P0756 BSA 20 mg/ml New England Biolabs nr kat. B9000 dNTP Mix Euroclone nr kat. EMR415001 USER enzym New England Biolabs nr kat. M5505 Inhibitor uracylu glikozylazy (UGI) New England Biolabs nr kat. M0281 Kinaza polinukleotydowa T4 New England Biolabs nr kat. M0201 Polimeraza DNA T4 New England Biolabs nr kat. M0203 Polimeraza DNA Bst New England Biolabs nr kat. M0537L Quick Ligase New England Biolabs nr kat. M2200 Polimeraza DNA PfuTurbo Cx Hotstart Agilent Technologies nr kat. 600414 Etanol Merck nr kat. 1009831000 Agilent D1000 ScreenTapes Agilent Technologies nr kat. 5067-5582 Agilent D1000 Reagents Agilent Technologies nr kat. 5067-5583 Agilent HS Screen Tapes Agilent Technologies nr kat. 5067-5584 Agilent HS Reagents Agilent Technologies nr kat. 5067-5585 Agaroza Lonza nr kat. 50004 Expand Long Range dNTPack Roche nr kat. 4829034001 Quick Blunting Kit New England BioLaba nr kat. E1201 AccuPrime Pfx DNA Polymerase Thermo Fisher Scientific nr kat. 12344024 Herculase II Fusion DNA Polymerase Agilent Technologies nr kat. 600679 Peletki wodorotlenku sodu Fisher Scientific nr kat. 10306200 Dynabeads M-270 Streptavidin Thermo Fisher Scientific nr kat. 65305 AmpliTaq Gold DNA Polymerase with Gold Buffer and MgCl2 Thermo Fisher Scientific nr kat. 4311806 Zestaw hybrydyzacyjny Agilent aCGH Agilent nr kat. 5188-5220 5M NaCl Sigma Aldrich nr kat. S5150 1M NaOH Sigma Aldrich nr kat. 71463 1 M Tris-HCl pH 8,0 Sigma Aldrich nr kat. AM9856 Zestaw do kwantyfikacji Quantifiler Trio DNA Thermo Fisher Scientific nr kat. 4482910 Cot-1 DNA Invitrogen nr kat. 15279011 Dynabeads MyOne Streptavidin T1 Thermo Fisher Scientific nr kat. 65602 DNA plemników łososia Thermo Fisher Scientific nr kat. 15632-011 Roztwór Denhardta Sigma-Aldrich nr kat. D9905-5Ml 20x bufor SCC Thermo Fisher Scientific nr kat. AM9770 2x bufor hybrydyzacyjny HI-RPM Agilent nr kat. 5118-5380 Krytyczne testy komercyjne Zestaw do oczyszczania PCR MinElute QIAGEN nr kat. 28006 Zestaw do oczyszczania PCR QIAquick QIAGEN nr kat. 28104 Zestaw do badania dsDNA HS Qubit, 500 testów Thermo Fisher Scientific nr kat. Q32854 Zestaw High Pure Extender z zestawu Roche High Pure Viral Nucleic Acid Large Volume, 40 reakcji Roche nr kat. 5114403001 Zestaw do usuwania nukleotydów QIAquick Quiagen nr kat. 28304 Zestaw odczynników MiSeq v3 (150 cykli) Illumina nr kat. MS-102-3001 Zestaw NextSeq 500/550 High Output v2.5 Illumina nr kat. 20024906 Złożone dane Dane sekwencjonowania od 5 niedawno zgłoszonych starożytnych osobników To badanie ENA: PRJEB74999 Dane genotypu od 5 niedawno zgłoszonych starożytnych osobników To badanie https://reich.hms.harvard.edu/datasets Oligonukleotydy IS1_adapter.P5: A∗C∗A∗C∗TCTTTCCCTACACGACG CTCTTCCG∗A∗T∗C∗T Meyer i Kircher47 Merc
k IS2_adapter.P7: G∗T∗G∗A∗CTGGAGTTCAGACGTG TGCTCTTCCG∗A∗T∗C∗T Meyer i Kircher47 Merck IS3_adapter.P5+P7: A∗G∗A∗T∗CGGAA∗G∗A∗G∗C Meyer i Kircher47 Merck IS6: CAAGCAGAAGACGGCATACGA Meyer i Kircher47 Merck IS5: AATGATACGGCGACCACCGA Meyer i Kircher47 Merck Sol_iPCR-MPI: CAAGCAGAAGACGGCATACG AGAT∗∗∗∗∗∗∗∗GTGACTGGAGTTCAGACGTGT Kircher i al.48 Merck P5_iPCR-LP: AATGATACGGCGACCACCGAGAT CTACAC∗∗∗∗∗∗∗∗∗ACACTCTTTCCCTACACGACGCTCTT Kircher i in.48 Merck Bio-T: Biotyna-TCAAGGACATCC∗G Maricic i in.22 Merck B: CGGATGTCCTT∗G Maricic i in.22 Merck BO1.P5.F: AATGATACGGCGACCACCGAGATCTA CACTCTTTCCCTACACGACGCTCTT CCGATCT-fosforan Maricic i in.22 Merck BO2.P5.R: AGATCGGAAGAGCGTCGTGTAGGGA AAGAGTGTAGATCTCGGTGGTCGCCG TATCATT-fosforan Maricic i in.22 Merck BO3.P7.part1.F: AGATCGGAAGAGCACACG TCTGAACTCCAGTCAC-fosforan Maricic i in.22 Merck BO4.P7.part1.R: GTGACTGGAGTTCAGACG TGTGCTCTTCCGATCT-fosforan Maricic i in.22 Merck BO5.P7.part2.F: ATCTCGTATGCCGTCTTC TGCTTG-fosforan Maricic i in.22 Merck BO6.P7.part2.R: CAAGCAGAAGACGGCA TACGAGAT-fosforan Maricic i in.22 Merck BO8.P5.part1.R:GTGTAGATCTCGGTGGTC GCCGTATCATT-fosforan Fu i in.49; Fu i in.50 Sigma-Aldrich BO10.P5.part2.R:AGATCGGAAGAGCGTC GTGTAGGGAAAGAGTGT-fosforan Fu i in.49; Fu i in.50 Sigma-Aldrich Sol_bridge_P5: AATGATACGGCGACCACCGA Maricic i in.22 Merck Sol_bridge_P7: CAAGCAGAAGACGGCATACGA Maricic i in.22 Merck LongR_mt1_For: GGCTTTCTCAACTTTTAAAGGATA Meyer i in.51 Merck LongR_mt1_Rev: TGTCCTGATCCAACATCGAG Me yer i in.51 Merck LongR_mt2_For: CCGTGCAAAGGTAGCATAATC Meyer i in.51 Merck LongR_mt2_Rev: TTACTTTTATTTGGAGTTGCACCA Meyer i in.51 Merck Probe for 1240K Panel Haak i in.23; Mathieson i in.52 N/A Oprogramowanie i algorytmy EAGER wersja 1.92.55 Peltzer i in.53 https://github.com/apeltzer/EAGER-GUI CircularMapper wersja 1.0 Peltzer i in.53 https://github.com/apeltzer/CircularMapper/releases Dedup v0.12.07 Peltzer i in.53 https://github.com/apeltzer /DeDup bwa v. 0.7.17-r1188 Li i Durbin54 https://github.com/lh3/bwa mapDamage2.0 Jónsson et al.55 https://ginolhac.github.io/mapDamage/ contamMix Fu et al.56 N/A Haplogrep3 Schönherr et al.57 https://haplogrep.i-med.ac.at HID Real-Time PCR Analysis Software v1.2 Thermo Fisher A24664 SeqPrep 1.1 https://github.com/jstjohn/SeqPrep N/A Preseq Daley i Smith58 N/A ANGSD Korneliussen i in.59 N/A SAMTools Li i Durbin54 N/A EIGENSOFT (wersja 7.2.1). https://github.com/DReichLab/EIG N/A ADMIXTOOLS v.6.0 https://github.com/dReichLab/AdmixTools N/A KIN Popli i in.60 N/A BREADR Rohrlach i in.61 N/A sexDetERRmine Lamnidis i in.62 N/A ADMIXTURE Alexander i in.63 N/A hapROH Ringbauer i in.28 N/A
Otwórz tabelę w nowej karcie

Model eksperymentalny i szczegóły podmiotu Odlewy gipsowe W 79 r. n.e. wybuch wulkanu Somma, który doprowadził do powstania Wezuwiusza, zniszczył Pompeje i zabił większość populacji. Gdy ludzie powoli umierali z powodu bolesnych, gorących i śmiercionośnych gazów i/lub popiołu, zostali pokryci pumeksem i popiołem. Następnie opady deszczu spowodowały, że ciała zostały scementowane w popiele, a podczas gdy tkanki miękkie uległy rozkładowi, stwardniały popiół zachował zarys ciał. Imponujące wykopaliska mające na celu odkrycie miasta Pompeje rozpoczęły się w 1748 roku i trwały sporadycznie, aż do momentu, gdy archeolog Giuseppe Fiorelli zaczął prowadzić badania systematycznie, prowadząc szczegółowe zapisy wszystkich znalezisk. W 1863 roku Fiorelli opracował metodę wykonywania odlewów gipsowych niektórych ofiar wybuchu, wlewając płynną kredę do pustych przestrzeni pozostawionych przez ciała w stwardniałym popiele.64 Metoda ta pozwoliła odtworzyć kształt ciał, nawet z ich wyrazem twarzy w chwili śmierci (rysunek S1). Odlewy gipsowe wykonano dla 104 z około 1000 ofiar znalezionych w Pompejach. Pobrano próbki starożytnych osób Podczas ostatnich wysiłków renowacji odlewów w Parku Archeologicznym Pompeje mieliśmy okazję zebrać fragmenty kości i zębów z wnętrza odlewów. Próbki szkieletu były dostępne przez uszkodzone części odlewów i wykazywały różny stopień zachowania. W niektórych przypadkach materiał kostny był zmieszany z gipsem i bardzo rozdrobniony i kruchy (Rysunek S1). Odlewy, z których pobrano próbki, zostały wykopane w siedmiu miejscach w Pompejach (Tabela S1). Pierwszy zestaw próbek (Zestaw 1: Numery odlewów 21, 22, 50, 51, 52 i 53) od sześciu osób z Domu Cryptoporticus i Domu Złotej Bransolety został wybrany do analizy molekularnej w celu sprawdzenia, czy rekonstrukcja relacji między nimi dokonana na podstawie badań archeologicznych została potwierdzona. Później zebrano kolejny zestaw próbek od ośmiu dodatkowych osób (Zestaw 2) (Tabela S1). Szczegóły metody Pobieranie próbek materiału szkieletowego i ekstrakcja DNA Pobieranie próbek, ekstrakcja DNA i przygotowanie biblioteki wszystkich okazów przeprowadzono w Jednostce Antropologii Molekularnej Uniwersytetu we Florencji, najnowocześniejszym ośrodku poświęconym analizie starożytnych próbek DNA. Aby usunąć potencjalne zanieczyszczenie, zewnętrzna warstwa fragmentów kości i zębów została usunięta mechanicznie za pomocą obrotowego narzędzia ściernego (seria Dremel 300). Po szczotkowaniu każdą próbkę napromieniowano światłem ultrafioletowym (λ = 254 nm) przez 45 min w Biolink DNA Crosslinker (Biometra). DNA wyekstrahowano z około 50 mg proszku zebranego z kości lub korzenia zęba zgodnie z protokołem zaprojektowanym w celu optymalizacji odzyskiwania bardzo krótkich fragmentów DNA w wysoce zdegradowanych próbkach.65 Przygotowanie biblioteki DNA Biblioteki Illumina NGS skonstruowano zaczynając od 20 μl ekstraktu DNA, zgodnie z protokołem dwuniciowego DNA, używając unikalnej kombinacji dwóch indeksów na okaz. Biblioteki bez żadnego traktowania UDG stworzono dla Zestawu 1,47, aby umożliwić ocenę wzorców deaminacji jako kryterium autentyczności.

Wyprodukowaliśmy biblioteki z częściowym traktowaniem UDG dla wszystkich 14 próbek66 do przesiewu i potencjalnego wychwytywania 1240K SNP. Kontrole negatywne sprawdzano zarówno za pomocą qPCR, jak i chipu Agilent 2100 Bioanalyzer DNA 1000. Po ligacji adaptera puste próbki miały stężenie o 4–5 rzędów niższe niż próbki biologiczne, podczas gdy indeksowane produkty PCR wykazały obecność tylko dimerów indeksów adaptera. Wychwytywanie i sekwencjonowanie mitochondrialnego DNA Na Uniwersytecie we Florencji biblioteki nieobrobione UDG z zestawu 1, wraz z ekstrakcją i pustymi próbkami biblioteki, zostały wzbogacone o mitochondrialne DNA zgodnie z protokołem multipleksowego wychwytywania22 i sekwencjonowane na instrumencie Illumina MiSeq przez 2×76+8+8 cykli. Po demultipleksowaniu, surowe dane sekwencyjne analizowano przy użyciu potoku specyficznego dla próbek starożytnego DNA53, przy użyciu następujących narzędzi zaimplementowanych w potoku. Adaptery zostały odcięte, a odczyty sparowanych końców z minimalnym nakładaniem się 10 pb zostały połączone w jedną sekwencję przy użyciu Clip&Merge w wersji 1.7.4. Następnie połączone odczyty zostały zmapowane na zmienionej sekwencji referencyjnej Cambridge, rCRS (GenBank: NC_012920) przez CircularMapper, aby uwzględnić kolistość genomu mitochondrialnego. Duplikaty zostały usunięte przy użyciu DeDup, narzędzia, które bierze pod uwagę oba końce fragmentów, aby rozpoznać je jako klonalne. Odczyty z jakością mapowania poniżej 30 zostały odrzucone. Wyniki mapowania tych próbek przedstawiono w Tabeli S3. Próbki 22, 50, 51, 52 i 53 wykazały średnie pokrycie wynoszące odpowiednio 55,39, 37,34, 3,43, 40,82 i 69,85, przy czym ponad 99% genomu mitochondrialnego było pokryte co najmniej 5 sekwencjami, z wyjątkiem próbki 51 o niższym pokryciu (ponad 80% genomu mitochondrialnego było pokryte co najmniej 2 sekwencjami). Nie uzyskano żadnych użytecznych danych dla próbki 21.

Drugie wychwytywanie mitochondrialnego DNA, wychwytywanie autosomalne i sekwencjonowanie

Przeszukaliśmy alikwoty wszystkich 14 przygotowanych bibliotek poddanych częściowej obróbce UDG, a także trzy puste próbki ekstrakcyjne i biblioteczne w starożytnych ośrodkach DNA Harvard Medical School, Boston MA, USA, metodą hybrydyzacji w roztworze, wzbogacając genom mitochondrialny,67 wraz z około 3000 jądrowych SNP przy użyciu wcześniej opisanego wychwytywania opartego na kulkach23,68 z sondami zastąpionymi przez amplifikowane oligonukleotydy syntetyzowane przez CustomArray Inc. Po wychwycie ukończyliśmy miejsca adaptera przy użyciu PCR, dołączając podwójne kombinacje indeksów do każdej wzbogaconej biblioteki. Sekwencjonowaliśmy produkty przesiewowe na Illumina NextSeq500 przy użyciu zestawów v.2 150 cycle dla 2 × 76 cykli i 2 × 7 cykli. Wyniki przesiewu podsumowano w danych S1A. W przypadku siedmiu bibliotek, które przeszły przesiew przeprowadzony w Harvard Medical School, przeprowadziliśmy przechwytywanie 1240K, stosując dwie rundy wzbogacania w roztworze na docelowym zestawie 1 237 207 SNP przy użyciu wcześniej zgłoszonych protokołów.49,52 Po zindeksowaniu produktów wzbogacenia w sposób, który przypisał unikalną kombinację indeksów do każdej biblioteki,69 zsekwencjonowaliśmy wzbogacone produkty na instrumencie Illumina NextSeq500 przy użyciu zestawów v.2 150 cycle dla 2 × 76 cykli i 2 × 7 cykli.

Kwantyfikacja i analiza statystyczna

Kwantyfikacja i ocena konserwacji DNA Ekstrakty DNA z zestawu 1 zostały skwantyfikowane w dwóch powtórzeniach na Uniwersytecie we Florencji, aby uzyskać wstępny opis konserwacji molekularnej tak szczególnego materiału. Obecność inhibitorów i poziom degradacji DNA oceniano przy użyciu zestawu Quantifiler Trio DNA Quantification Kit (Thermo Fisher Scientific, Oyster Point, Kalifornia). Reakcje amplifikacji PCR w czasie rzeczywistym zawierały 10,5 μl mieszanki Primer-Probe Mix, 12,5 μl mieszanki Master Mix i 2,0 μl próbki DNA zgodnie z instrukcją użytkownika.70 Dane analizowano przy użyciu oprogramowania HID Real-Time PCR Analysis Software v1.2 z podanymi ustawieniami. Wyniki kwantyfikacji podsumowano w tabeli S2. Nie uzyskano żadnych wyników z próbki 21 dla wszystkich analizowanych celów. Wartości kwantyfikacji uzyskane z próbek 22 i 50 wynosiły zero dla dużego autosomalnego celu, prawdopodobnie z powodu degradacji DNA w zbyt krótkich fragmentach. Podobne wyniki uzyskano dla markera Y, w którym stężenie wahało się od 2,8 do 107 pg/μl dla wszystkich pięciu próbek. Pozytywne wyniki dla markera Y sugerowały, że ….. próbki były męskie. Ponieważ nie uzyskano żadnych wyników dla dużego autosomalnego markera z dwóch próbek, indeks degradacji (DI) mierzący typowe zanieczyszczenie starożytnym DNA można było obliczyć wiarygodnie tylko dla próbek 52, 53 i 51. Szacowane wartości DI dla tych próbek wynosiły odpowiednio 19,2, 7,6 i 14,8. Jak podano w instrukcji użytkownika,70 te wartości DI wskazują, że DNA w próbkach było umiarkowanie/znacznie zdegradowane, co jest zgodne z autentycznym starożytnym DNA. Nie zaobserwowano znaczącej zmiany w stosunku do kontroli bez matrycy w IPC CT, co wskazuje, że jeśli występowało hamowanie, nie było ono wystarczające, aby znacząco stłumić amplifikację IPC. Przetwarzanie danych sekwencjonowania Przycięliśmy kody kreskowe i adaptery z surowych sekwencji i połączyliśmy pary odczytów z co najmniej 10 lub 15 nakładającymi się parami zasad zgodnie z długością sekwencjonowanych odczytów i zmapowaliśmy uzyskane odczyty do ludzkiego genomu referencyjnego, hg19 [GRCh37] przy użyciu polecenia samse programu BWA (wersja 0.6.1).54 Cztery próbki dostarczają kompletne lub prawie kompletne genomy mitochondrialne po wzbogaceniu docelowym mtDNA przeprowadzonym na bibliotekach nieobrobionych UDG przygotowanych we Florencji na pierwszej partii sześciu zebranych próbek. Oceniliśmy autentyczność tych genomów mitochondrialnych, badając charakterystyczne wzorce uszkodzeń aDNA55 i potwierdzając pojedyncze źródło sekwencji mitochondrialnych przy użyciu contamMix56 (Tabela S3). Sekwencje konsensusowe osób zostały przesłane do Haplogrep357 w celu określenia haplogrup mtDNA. Określono również haplogrupy mitochondrialne dla danych uzyskanych z bibliotek poddanych częściowemu działaniu UDG we wszystkich 14 próbkach za pomocą Haplogrep3.57 W przypadku próbek przetworzonych w obu laboratoriach porównano profile mitochondrialne uzyskane z dwóch różnych protokołów bibliotecznych, co stanowiło dalsze potwierdzenie autentyczności danych. Określiliśmy płeć genetyczną na podstawie danych z przechwytywania 1240K za pomocą sexDetERRmine.62 Spośród siedmiu osób, które przeszły przesiew, udało nam się ustalić, że pięć było genetycznie męskich (zgodnie z jednym chromosomem X i jednym chromosomem Y oraz niezgodnie z dwoma chromosomami XX i brakiem chromosomu Y), podczas gdy dwie osoby pozostały nieokreślone z powodu niskiego pokrycia (dane S1A). Wzory uszkodzeń ocenione za pomocą MapDamage 2.055 były niższe niż w danych wygenerowanych w przechwytywaniu mtDNA przeprowadzonym we Florencji, co jest oczekiwane ze względu na częściowe leczenie UDG zastosowane w bibliotekach przechwytywania 1240K (Tabela 1). Oszacowania płci pozostały stałe w zakresie rozdzielczości przedziałów ufności po zachowaniu tylko odczytów z błędnymi włączeniami C-do-T i G-do-A odpowiednio na końcach 5′ i 3′, przy użyciu pmdtools v0.6071 (dane S1A).

Oszacowaliśmy heterozygotyczność na chromosomie X samców przy użyciu ANGSD.59 W przypadku dwóch samców z wystarczającym pokryciem co najmniej 200 informacyjnych SNP na chromosomie X oszacowaliśmy wskaźniki skażenia jądrowego poniżej 4%. Osoby z działającymi danymi miały medianę pokrycia na zestawie 1240K SNP wynoszącą 0,054 (zakres 0,006–0,437). Przygotowaliśmy zbiór danych genotypowych do analizy genetycznej populacji, używając zmapowanych sekwencji z dwoma przyciętymi zasadami z końców se, wybierając losowo jeden allel w miejscach wychwytu 1240K i zachowując pięć osobników do analizy, które miały co najmniej 10 000 SNP objętych co najmniej raz (zakres 53 739–364 533). Wyniki podsumowano w Danych S1A. Przypisaliśmy haplogrupy chromosomów Y zgodnie z filogenezą Yfull 8.09, używając wszystkich przyciętych odczytów zmapowanych na chromosomie Y i zgłaszamy najbardziej diagnostyczne SNP w dół (Dane S1C). Analiza genetyki populacji i pokrewieństwa Zebraliśmy zestaw danych referencyjnych składający się z danych całego genomu od 2674 starożytnych osobników72, a także wcześniej zgłoszonych danych sekwencjonowania całego genomu od 346 współczesnych osobników na całym świecie73,74,75,76 i połączyliśmy pięć nowo zgłoszonych pseudohaploidalnych genotypów z Pompejów. Połączyliśmy ten zestaw danych z 3291 współczesnymi osobnikami ze 109 populacji na całym świecie genotypowanych na podstawie SNP Affymetrix Human Origins (HO).68,77,78,79,80,81 Użyliśmy funkcji smartpca programu EIGENSOFT (57) do wykonania analizy głównych składowych (PCA) przy użyciu domyślnych parametrów, z ustawieniami lsqproject:YES i numoutlier:0. Przeprowadziliśmy projekcję starożytnych osobników na wykres PCA 1196 współczesnych osobników z zachodniej Eurazji i 1900 współczesnych osobników z całego świata, ograniczając się do zestawu HO 597 573 SNP.

Przeprowadziliśmy klasteryzację przy użyciu nienadzorowanego ADMIXTURE,63 po przycięciu SNP w nierównowadze sprzężeń ze sobą za pomocą PLINK54 przy użyciu parametru –indep-pairwise 200 25 0,4, co dało nam 282 184 SNP. Przeprowadziliśmy analizę ADMIXTURE dla wartości k między 2 a 15, wykonując 5 powtórzeń przy każdej wartości k i zachowując powtórzenie o najwyższym prawdopodobieństwie przy każdym k (rysunki S2 i S3). Wykonaliśmy analizy qpWave11,12/qpAdm11 z domyślnymi parametrami i allsnps: TAK, wstępnie obliczając statystyki f przy użyciu qpfstats (https://github.com/DReichLab/AdmixTools/blob/master/qpfs.pdf). Wszystkie narzędzia są zaimplementowane ….

d w ADMIXTOOLS. Jako „właściwe” grupy zewnętrzne wykorzystaliśmy zestaw 9 populacji: „OldAfrica” (różnorodny zbiór starożytnych osobników afrykańskich bez dowodów na domieszkę związaną z zachodnią Eurazjatycką82,83,84), MAR_Taforalt_EpiP (epipaleolityczni mieszkańcy Afryki Północnej85), RUS_AfontovaGora3 (mezolityczny łowca-zbieracz z Syberii86), RUS_EHG (łowca-zbieracz z północno-wschodniej Europy52,87), GEO_CHG.SG (łowca-zbieracz z Kaukazu88), WHGB (łowca-zbieracz ze wschodniego Bałtyku i Bałkanów52,87), ISR_Natufian_EpiP (lewantyńscy łowcy-zbieracze z epipaleolitu68), TUR_EpiPal_Pinarbasi (anatolijski łowca-zbieracz z epipaleolitu89) i TUR_C_Boncuklu_PPN (anatolijscy rolnicy preceramiczni89). Jako dystalne populacje źródłowe użyliśmy TUR_Marmara_Barcin_N (północno-zachodni anatolijscy rolnicy neolityczni52), Mediterranean_CA_NorthAfrican (dwie osoby z chalkolitycznej Iberii i Sardynii o całkowicie północnoafrykańskim pochodzeniu90,91), WHGA (łowcy-zbieracze z zachodniej i centralnej Europy20,52,86,92,93,94), Levant_PPN (lewantyńscy rolnicy preceramiczni68), Steppe_EMBA (pasterze ze stepów pontyjsko-kaspijskich związani z kompleksami kulturowymi Jamna i Połtawka20,52,95) i IRN_Ganj_Dareh_N (neolityczni rolnicy z regionu Zagros68,96). W modelowaniu przy użyciu populacji źródeł proksymalnych, 19,20,24,52,77,78,91,95,97,98,99,100,101,102,103,104,105 zastąpiliśmy GEO_CHG.SG przez IRN_Ganj_Dareh_N w grupach zewnętrznych, aby uniknąć efektu wsadowego przyciągania między źródłami i grupami zewnętrznymi wytworzonego przy użyciu tej samej strategii przetwarzania. Dodatkowo dodaliśmy TUR_Marmara_Barcin_N i Steppe_EMBA do grup zewnętrznych i zastosowaliśmy podejście „konkurencyjne”, dodając nieużywane źródła do grup zewnętrznych.
Odpowiednie identyfikatory genetyczne dla wszystkich grup zewnętrznych i grup źródłowych są wymienione w danych S2A, a wyniki modelowania qpAdm znajdują się w danych S2B i S2C.
Oszacowaliśmy pokrewieństwo między osobnikami Pompejusza, używając KIN60,63 z domyślnymi parametrami i BREAD R61, określając odległość co najmniej 50 000 pb między nakładającymi się miejscami. Wyniki przedstawiono w danych S1D. Użyliśmy hapROH28 na osobniku objętym ponad 350 000 SNP, aby wykryć serie homozygotyczności (rysunek S4). Przewidywanie cech fenotypowych Przeanalizowaliśmy dane genomiczne dla pięciu wcześniej wybranych osobników, aby przewidzieć cechy fenotypowe związane z chorobami i widocznymi zewnętrznie cechami (EVC).
Zebraliśmy informacje o genetycznie uwarunkowanych schorzeniach medycznych dostępnych w SNPedia (https://www.snpedia.com/index.php/Category:Is_a_medical_condition zaktualizowano w październiku 2023 r.) i posortowaliśmy je w dziesięć makroobszarów (dane S3). Wybrano łącznie 94477 SNP. Następnie szukamy tych warunków w katalogu GWAS (https://www.ebi.ac.uk/gwas/) w celu uzyskania dalszego opisu cech i listy wariantów genomicznych zaangażowanych w każdą cechę (dane S3A i S3B). BCFTools (wersja 1.10.2) z funkcją mpileup zostało użyte do wygenerowania pliku VCF zawierającego prawdopodobieństwa genotypów w wybranych pozycjach dla poprzednich plików wyrównania (BAM), ustawiając minimalne progi jakości mapowania (-q) i bazy (-Q) na 20. Ogólnie rzecz biorąc, uzyskaliśmy maksymalne pokrycie 3x dla wybranych SNP, przy czym większość z nich objęła 1x. Uzyskane warianty zostały adnotowane za pomocą SNPnexus (https://www.snp-nexus.org/v4/). Do analizy cech fenotypowych związanych z widocznymi zewnętrznie cechami (EVC) uzyskano 41 SNP z panelu HIrisPlex-S29, które są związane z pigmentacją oczu, włosów i skóry (dane S3A i S3B). Do wybrania tych wariantów zastosowano to samo podejście, które opisano dla cech powiązanych z chorobą. Następnie uzyskane warianty związane z SNP w panelu HIrisPlex-S przeanalizowano przy użyciu skryptu oprogramowania R dostarczonego dla systemu HIrisPlex-S, co pozwoliło nam przekonwertować wyniki do formatu wymaganego dla modelu predykcyjnego online Hirsiplex-S.
Warianty związane z chorobami genotypowanymi dla każdej próbki są wymienione w danych S3C–S3G. Jak pokazano w tej tabeli, wykryto kilka alleli ryzyka dla różnych chorób, ale ze względu na niskie pokrycie i obecność tylko kilku alleli ryzyka dla każdej badanej choroby, nie można było przewidzieć z pewnością żadnych cech patologicznych. Przykładem tego może być osoba 53, która z czterech alleli ryzyka zidentyfikowanych dla choroby Kawasaki,106 ma tylko dwa. Kolor skóry, oczu i włosów to jedyne cechy, dla których możliwe jest przewidywanie, i udało się potwierdzić, że osoba 52 miała czarne włosy i ciemną skórę, a osoby 25, 51 i 53 miały brązowe oczy (dane S3D–S3G).
Analiza strontu, węgla i tlenu
Przetwarzanie próbek zęba Pompejusza (osoba 25, dolny przedtrzonowiec) odbyło się w laboratorium chemii kości, na Wydziale Antropologii, University of Florida, a wszystkie spektrometrie masowe przeprowadzono w Wydziale Nauk Geologicznych, University of Florida. Mały kawałek szkliwa zęba od osoby 25 (UF BCL 4300) został usunięty z korony za pomocą wiertarki stomatologicznej NSK i dysku rozdzielającego Dedeco. „Kawałek” szkliwa zęba (∼30 mg) został usunięty …. ved oczyszczono z przylegających zanieczyszczeń i zębiny pod mikroskopem sekcyjnym, używając zamontowanego wiertła stomatologicznego wyposażonego w stożkowe wiertło z węglika wolframu. Wytworzono dwa kawałki „oczyszczonego” szkliwa zębowego (∼10 mg każdy), jeden do pomiaru stosunków izotopów węgla i tlenu przy użyciu spektrometrii masowej stosunku izotopów (IRMS), a drugi do analizy izotopów strontu przy użyciu spektrometrii masowej z jonizacją termiczną (TIMS).
Próbka 10 mg przeznaczona do analizy izotopów węgla i tlenu została zmielona przy użyciu zestawu agatów oczyszczonych kwasem, a proszek szkliwa zębowego umieszczono w wstępnie zważonej probówce mikrocentrifugi o pojemności 0,5 ml. Aby utlenić próbkę, dodano do niej 2% roztwór podchlorynu sodu (NaCIO) na ~8 godzin, przepłukano do odczynu obojętnego wodą Milli-Q, a następnie poddano ~8 godzinom wstępnej obróbki przy użyciu 0,2 M kwasu octowego (CH3COOH). Wstępnie obrobioną próbkę przepłukano do odczynu obojętnego wodą Milli-Q i umieszczono w zamrażarce w temperaturze -20° C. Po zamrożeniu próbkę liofilizowano przez ~48 godzin, a jej ostateczną masę odnotowano przed załadowaniem próbki do IRMS. Stosunek stabilnych izotopów węgla i tlenu zmierzono dwukrotnie 6 września 2017 r. za pomocą IRMS (Finnigan MAT 252) przy użyciu urządzenia do przygotowywania węglanów Kiel III. Precyzja standardów NBS-19 (n = 10) podczas przebiegu dla δ13C wynosiła 0,02‰, a dla δ18O wynosiła 0,07‰. Kolejną próbkę 10 mg poddano badaniom radiogenicznych stosunków strontu i przeniesiono do laboratorium klasy 1000 Clean Lab w Departamencie Nauk Geologicznych Uniwersytetu Florydy. Kawałek szkliwa zęba rozpuszczono w 50% kwasie azotowym (HNO3) na gorącej płycie (100° C) przez 24 godziny w uprzednio oczyszczonej i zamkniętej fiolce teflonowej. Fiolki otwarto i odparowano do sucha przed chromatografią jonową. Wysuszony osad rozpuszczono w 3,5 N HNO3 i załadowano na kolumnę wymiany kationów wypełnioną żywicą specyficzną dla strontu (Eichrom Technologies, Inc.) w celu oddzielenia strontu od innych jonów. Następnie próbkę Sr załadowano na odgazowany żarnik wolframowy, a 87Sr/86Sr zmierzono na Micromass Sector 54 TIMS. Próbkę poddano działaniu 200+ współczynników przy 1,5 V i znormalizowano do 86Sr/88Sr = 0,1194 zgodnie z metodami opisanymi w Hodell et al.,107 w porównaniu z powtarzanymi analizami standardowego odniesienia NBS-987. Uzyskane pomiary izotopów porównano z wartościami podanymi w literaturze.38,39,40,41,44,44 Wyniki analizy stabilnych izotopów przedstawiono na rysunku 4. Informacje uzupełniające (5) PDF (7,86 MB) Dokument S1. Rysunki S1–S4 i tabele S1–S3 Arkusz kalkulacyjny (50,02 KB) Dane S1. Dane pomocnicze do pobierania próbek, przetwarzania próbek i opisu danych, związane z metodami STAR (A) Przegląd metainformacji próbki, przetwarzania i statystyk bibliotecznych. (B) Wyniki datowania radiowęglowego AMS. (C) Przypisanie haplogrup chromosomów Y. (D) Wyniki analiz pokrewieństwa przy użyciu BREADR i KIN. Arkusz kalkulacyjny (68,37 KB) Dane S2. Dane pomocnicze do analizy genetycznej populacji, związane z metodami STAR (A)
Osoby uwzględnione w analizie qpAdm i ich etykiety populacji. (B) Wyniki modelowania qpAdm przy użyciu dystalnych populacji źródłowych, związane z rysunkiem 3. (C) Wyniki modelowania qpAdm przy użyciu proksymalnych populacji źródłowych, pokazane jako modele robocze z p ≥ 0,01. (D) Wyniki modelowania qpAdm Osoby 52 przy użyciu proksymalnych populacji źródłowych. Arkusz kalkulacyjny (699,06 KB) Dane S3. Dane pomocnicze do oceny ryzyka fenotypowego i chorobowego, związane z metodami STAR (A) Prawdopodobieństwo fenotypu ocenione za pomocą systemu HIrisPlex-S. (B) Lista markerów użytych do oceny cech fenotypowych i ryzyka chorobowego. (C) Wyniki genotypowania markerów ryzyka choroby, osoba 22. (D) Wyniki genotypowania markerów ryzyka choroby, osoba 25. (E) Wyniki genotypowania markerów ryzyka choroby, osoba 51. (F) Wyniki genotypowania markerów ryzyka choroby, osoba 52. (G) Wyniki genotypowania markerów ryzyka choroby, osoba 53. PDF (10,65 MB) Dokument S2. Artykuł plus informacje uzupełniające Odniesienia
1. Amato, V. ∙ Covolan, M. ∙ Dessales, H. … Mikrozonacja sejsmiczna w Parku Archeologicznym Pompejów (południowe Włochy): lokalne współczynniki wzmocnienia sejsmicznego Geosciences. 2022; 12:275 Crossref Scopus (2) Google Scholar
2. De Carolis, E. ∙ Patricelli, G. ∙ Ciarallo, A. Rinvenimenti di corpi umani nell’area urbana di Pompei Riv. di Stud. Pompejani. 1998; 9:75-123 Google Scholar
3. De Carolis, E. ∙ Patricelli, G. Le vittime dell’eruzione Oplontis, P.E. ∙ D’Ambrosio, A. ∙ Guzzo, P.G. … Historie nieeruzji Mondadori Electa, 2003 Google Scholar
4. Luongo, G. ∙ Perrotta, A. ∙ Scarpati, C. … Wpływ wybuchu wulkanu z 79 r. n.e. na Pompeje, II. Przyczyny śmierci mieszkańców wnioskowane na podstawie analizy stratygraficznej i przestrzennego rozmieszczenia ofiar śmiertelnych J. Volcanol. Geotherm. Res. 2003; 126:169-200 Crossref Scopus (76) Google Scholar
5. Lazer, E. Wskrzeszanie Pompejów Routledge, 2009 Crossref Scopus (43) Google Scholar

6. Lazer, E. ∙ Welch, K. ∙ Vu, D. … Wewnątrz odlewów ofiar Pompejów: Wyniki z pierwszego sezonu Pompejańskiego Projektu Obsad w 2015 r. Pap. Br. Sch. Rzym. 2021; 89 ….

:101-136 Crossref Scopus (3) Google Scholar
7. Cipollaro, M. ∙ Di Bernardo, G. ∙ Galano, G. … Starożytne DNA w ludzkich szczątkach kostnych z wykopalisk archeologicznych w Pompejach Biochem. Biophys. Res. Commun. 1998; 247:901-904 Crossref Scopus (39) PubMed Google Scholar
8. Di Bernardo, G. ∙ Del Gaudio, S. ∙ Galderisi, U. … 2000-letnie starożytne koniowate: lekcja starożytnego DNA z pozostałości z Pompejów J. Exp. Zool. Pt. B. 2004; 302B:550-556 Crossref Scopus (10) Google Scholar
9. Di Bernardo, G. ∙ Galderisi, U. ∙ Del Gaudio, S. … Charakterystyka genetyczna koniowatych z Pompejów i Herkulanum pogrzebanych przez Wezuwiusza w 79 r. n.e. J. Cell. Physiol. 2004; 199:200-205 Crossref Scopus (17) PubMed Google Scholar
10. Guarino, F.M. ∙ Buccelli, C. ∙ Graziano, V. … Odzyskiwanie i amplifikacja starożytnego DNA ofiar z Herkulanum zabitych przez gorące fale Wezuwiusza w 79 r. n.e. Turk. J. Biol. 2017; 41:640-648 Crossref Scopus (4) Google Scholar
11. Di Bernardo, G. ∙ Del Gaudio, S. ∙ Galderisi, U. … Starożytne DNA i relacje rodzinne w domu pompejańskim Ann. Hum. Genet. 2009; 73:429-437 Crossref Scopus (11) PubMed Google Scholar
12. Cipollaro, M. ∙ Di Bernado, G. ∙ Forte, A. … Analiza histologiczna i amplifikacja starożytnego DNA ludzkich szczątków kostnych znalezionych w domu Caiusa Iuliusa Polybiusa w Pompejach Croat. Med. J. 1999; 40:392-397 PubMed Google Scholar
13. Di Bernardo, G. ∙ Del Gaudio, S. ∙ Cammarota, M. … Enzymatyczna naprawa wybranych usieciowanych cząsteczek homodupleksowych zwiększa ratowanie genów jądrowych z pozostałości z Pompejów i Herkulanum Nucleic Acids Res. 2002; 30, e16 Crossref Scopus (32) PubMed Google Scholar
14. Manca, P. ∙ Farina, V. ∙ Gadau, S. … Cechy fenotypowe świń domowych hodowanych w rzymskich osadach w Pompejach i Caralis Ital. J. Anat. Embryol. 2004; 109:105-114 PubMed Google Scholar
15. Cipollaro, M. Wzmocnienie starożytnych sekwencji mtDNA koniowatych z Pompejów J. Cell. Biochem. 2011; 112:363-364 Crossref Scopus (3) PubMed Google Scholar
16. Gurney, S.M.R. Ponowne odwiedzenie starożytnych sekwencji mtDNA koniowatych z Pompejów J. Cell. Biochem. 2010; 111:1080-1081 Crossref Scopus (4) PubMed Google Scholar
17. Corbino, C.A. ∙ Comegna, C. ∙ Amoretti, V. … Eksploatacja koni w Pompejach (AD 79) J. Archaeol. Sci. Rep. 2023; 48, 103902 Crossref Scopus (2) Google Scholar
18. Scorrano, G. ∙ Viva, S. ∙ Pinotti, T. … Bioarcheologiczny i paleogenomiczny portret dwóch Pompejuszów, którzy zginęli podczas wybuchu Wezuwiusza w 79 r. n.e. Sci. Rep. 2022; 12:6468 Crossref Scopus (9) PubMed Google Scholar
19. Antonio, M.L. ∙ Gao, Z. ∙ Moots, H.M. … Starożytny Rzym: genetyczne skrzyżowanie Europy i Morza Śródziemnego Science. 2019; 366:708-714 Odnośnik Skopus (129) PubMed Scholar Google
20. Mathieson, I. ∙ Alpaslan-Roodenberg, S. ∙ Posth, C. … Historia genomowa Europy Południowo-Wschodniej Natura. 2018; 555:197-203 Odnośnik Skopus (439) PubMed Scholar Google
21. Osanna, M. ∙ Capurso, A. ∙ Masseroli, S.M. I Calchi di Pompei da Giuseppe Fiorelli ad Oggi L’Erma di Bretschneider, 2021 …. itd – jak w oryginale anglojęzycznym.

Podziel się!